Incidental Mutation 'R1102:Gle1'
ID98146
Institutional Source Beutler Lab
Gene Symbol Gle1
Ensembl Gene ENSMUSG00000019715
Gene NameGLE1 RNA export mediator (yeast)
Synonyms4933405K21Rik
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29935426-29960371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29944054 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 437 (I437M)
Ref Sequence ENSEMBL: ENSMUSP00000019859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019859]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019859
AA Change: I437M

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019859
Gene: ENSMUSG00000019715
AA Change: I437M

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
coiled coil region 154 275 N/A INTRINSIC
coiled coil region 306 356 N/A INTRINSIC
Pfam:GLE1 397 650 2.4e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149730
Meta Mutation Damage Score 0.0813 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Gle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Gle1 APN 2 29939289 splice site probably benign
IGL01880:Gle1 APN 2 29943750 missense possibly damaging 0.53
IGL02293:Gle1 APN 2 29957760 missense probably benign 0.00
IGL02859:Gle1 APN 2 29949228 missense probably damaging 1.00
IGL03368:Gle1 APN 2 29943793 missense probably damaging 1.00
R0535:Gle1 UTSW 2 29957805 missense probably damaging 1.00
R0608:Gle1 UTSW 2 29940228 missense probably benign 0.01
R0839:Gle1 UTSW 2 29958450 missense probably benign 0.28
R0908:Gle1 UTSW 2 29936121 missense probably benign 0.06
R1202:Gle1 UTSW 2 29949265 missense probably damaging 1.00
R1302:Gle1 UTSW 2 29952552 splice site probably null
R2184:Gle1 UTSW 2 29949018 missense probably damaging 1.00
R2213:Gle1 UTSW 2 29949301 missense probably damaging 0.97
R4151:Gle1 UTSW 2 29944044 missense probably damaging 1.00
R4172:Gle1 UTSW 2 29938526 missense probably benign
R4732:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4733:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4775:Gle1 UTSW 2 29936061 missense possibly damaging 0.86
R4817:Gle1 UTSW 2 29936211 missense probably benign 0.00
R4824:Gle1 UTSW 2 29940203 missense possibly damaging 0.82
R4869:Gle1 UTSW 2 29936020 missense possibly damaging 0.69
R4909:Gle1 UTSW 2 29936080 missense probably benign 0.01
R5036:Gle1 UTSW 2 29936211 missense probably benign 0.00
R5298:Gle1 UTSW 2 29948943 missense probably benign 0.02
R5903:Gle1 UTSW 2 29940281 missense probably benign 0.00
R6345:Gle1 UTSW 2 29936115 missense probably benign 0.00
R6529:Gle1 UTSW 2 29935527 missense possibly damaging 0.56
R7144:Gle1 UTSW 2 29943793 missense probably damaging 1.00
R7984:Gle1 UTSW 2 29938576 missense probably damaging 0.99
R8154:Gle1 UTSW 2 29938607 critical splice donor site probably null
R8203:Gle1 UTSW 2 29935510 missense probably benign
R8348:Gle1 UTSW 2 29942544 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCTGACCAGCAGCAAGGATAGTC -3'
(R):5'- GGGATGCAACCTACATCTGAACGTG -3'

Sequencing Primer
(F):5'- TGTGCCCTACAGCCTGATG -3'
(R):5'- TCTCCAGCCCTGAATACTGT -3'
Posted On2014-01-05