Incidental Mutation 'R1102:Cd36'
ID98161
Institutional Source Beutler Lab
Gene Symbol Cd36
Ensembl Gene ENSMUSG00000002944
Gene NameCD36 molecule
Synonymsfatty acid translocase, FAT, Scarb3
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location17781690-17888801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17814213 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 170 (F170S)
Ref Sequence ENSEMBL: ENSMUSP00000143061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197574] [ENSMUST00000197890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082367
AA Change: F170S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: F170S

DomainStartEndE-ValueType
Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165232
AA Change: F170S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: F170S

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169095
AA Change: F170S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: F170S

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170051
AA Change: F170S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: F170S

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197574
SMART Domains Protein: ENSMUSP00000143107
Gene: ENSMUSG00000002944

DomainStartEndE-ValueType
Pfam:CD36 12 142 1.8e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197890
AA Change: F170S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: F170S

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Meta Mutation Damage Score 0.6807 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Cd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17787702 missense probably damaging 0.99
IGL01355:Cd36 APN 5 17813074 missense possibly damaging 0.76
IGL02140:Cd36 APN 5 17828768 splice site probably benign
IGL02385:Cd36 APN 5 17814719 missense probably benign 0.31
IGL02626:Cd36 APN 5 17797128 nonsense probably null
IGL02645:Cd36 APN 5 17785880 missense probably benign 0.01
IGL03149:Cd36 APN 5 17820565 missense probably benign 0.02
detached UTSW 5 17814723 missense probably damaging 1.00
oblivious UTSW 5 17874966 intron probably benign
E0370:Cd36 UTSW 5 17785749 nonsense probably null
F5770:Cd36 UTSW 5 17820528 frame shift probably null
R0266:Cd36 UTSW 5 17798252 missense probably benign 0.09
R1120:Cd36 UTSW 5 17785828 missense possibly damaging 0.67
R1170:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R1551:Cd36 UTSW 5 17797122 missense probably benign 0.00
R1918:Cd36 UTSW 5 17797036 nonsense probably null
R4090:Cd36 UTSW 5 17785720 critical splice donor site probably null
R4197:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R5602:Cd36 UTSW 5 17814792 missense possibly damaging 0.94
R5647:Cd36 UTSW 5 17814765 missense probably damaging 1.00
R5867:Cd36 UTSW 5 17785735 missense probably benign 0.05
R6151:Cd36 UTSW 5 17795595 missense probably damaging 1.00
R6400:Cd36 UTSW 5 17814723 missense probably damaging 1.00
R6419:Cd36 UTSW 5 17797152 missense probably benign
R7081:Cd36 UTSW 5 17814704 missense probably damaging 1.00
R7195:Cd36 UTSW 5 17814189 missense probably damaging 1.00
R7420:Cd36 UTSW 5 17788274 missense probably benign 0.09
R8677:Cd36 UTSW 5 17820495 missense probably damaging 1.00
V7580:Cd36 UTSW 5 17820528 frame shift probably null
Z1088:Cd36 UTSW 5 17795575 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTCAATACCTCAAGGGAACATTCACA -3'
(R):5'- TGGATAGATGACCCAATCAGCCTAATCA -3'

Sequencing Primer
(F):5'- AGCTCTAGAAAATGAGAAAAGCTATG -3'
(R):5'- TAGACTAGGCAGGATTTGTCAG -3'
Posted On2014-01-05