Incidental Mutation 'R1102:Vmn2r53'
ID 98172
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission 039175-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R1102 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 12315397-12342583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12332410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118665
Predicted Effect possibly damaging
Transcript: ENSMUST00000170412
AA Change: D413G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: D413G

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,211,460 (GRCm39) T203M probably damaging Het
Acy3 C T 19: 4,037,850 (GRCm39) T119I probably damaging Het
Ccdc6 C A 10: 70,023,636 (GRCm39) H400Q possibly damaging Het
Ccna1 T C 3: 54,958,281 (GRCm39) D134G probably damaging Het
Cct2 A T 10: 116,896,545 (GRCm39) probably null Het
Cd36 A G 5: 18,019,211 (GRCm39) F170S possibly damaging Het
Cep350 G A 1: 155,807,264 (GRCm39) P718S probably damaging Het
Cimip1 T A 2: 173,364,516 (GRCm39) D20E probably damaging Het
Ctnna3 A T 10: 64,421,774 (GRCm39) I523L probably benign Het
Dnah1 G T 14: 31,018,414 (GRCm39) Y1405* probably null Het
Dnah8 T A 17: 31,073,738 (GRCm39) probably null Het
Drd3 T C 16: 43,582,846 (GRCm39) L113S probably damaging Het
Emsy T C 7: 98,251,796 (GRCm39) T735A probably damaging Het
Epha5 A G 5: 84,381,434 (GRCm39) probably benign Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fbxo10 A G 4: 45,043,672 (GRCm39) L717P probably damaging Het
Galnt10 T C 11: 57,671,871 (GRCm39) probably benign Het
Gle1 T G 2: 29,834,066 (GRCm39) I437M possibly damaging Het
Gpr137b T C 13: 13,539,616 (GRCm39) probably benign Het
Gsta1 T C 9: 78,149,777 (GRCm39) F197L probably damaging Het
Icam1 G A 9: 20,939,132 (GRCm39) V502M possibly damaging Het
Ido1 T A 8: 25,083,156 (GRCm39) I90F probably damaging Het
Il4ra G A 7: 125,173,889 (GRCm39) probably null Het
Med12l T A 3: 59,152,257 (GRCm39) M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 (GRCm39) E104G possibly damaging Het
Mms19 T C 19: 41,939,284 (GRCm39) E495G possibly damaging Het
Mrc2 A G 11: 105,231,647 (GRCm39) I820V probably benign Het
Naip6 T C 13: 100,440,923 (GRCm39) K286E possibly damaging Het
Ndrg1 T C 15: 66,816,685 (GRCm39) Y110C probably damaging Het
Or1e1c G A 11: 73,265,700 (GRCm39) V45I probably benign Het
Or4a78 A T 2: 89,497,814 (GRCm39) C139S probably damaging Het
Or5b118 T C 19: 13,448,771 (GRCm39) C146R probably damaging Het
Or5b3 G A 19: 13,388,454 (GRCm39) V174M probably damaging Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Pdzd4 G A X: 72,839,052 (GRCm39) R419C probably damaging Het
Pnpla7 G T 2: 24,886,177 (GRCm39) M3I probably damaging Het
Popdc3 A G 10: 45,192,642 (GRCm39) probably benign Het
Ppp5c A G 7: 16,756,368 (GRCm39) F112S probably benign Het
Rbp3 A G 14: 33,678,313 (GRCm39) T754A possibly damaging Het
Reep6 A G 10: 80,171,080 (GRCm39) T319A probably benign Het
Rfx3 A G 19: 27,845,000 (GRCm39) V43A possibly damaging Het
Rint1 A G 5: 24,010,565 (GRCm39) probably benign Het
Sacm1l T G 9: 123,411,363 (GRCm39) V384G probably damaging Het
Shox2 A T 3: 66,885,628 (GRCm39) L149Q probably damaging Het
Sipa1 T C 19: 5,702,782 (GRCm39) H805R probably benign Het
Skic2 T C 17: 35,059,082 (GRCm39) D1095G probably benign Het
Slc5a3 G T 16: 91,874,765 (GRCm39) W274L probably damaging Het
Spata31e4 A G 13: 50,857,118 (GRCm39) T919A probably benign Het
Sptbn1 G T 11: 30,070,785 (GRCm39) H1524Q possibly damaging Het
Ssr1 G T 13: 38,171,591 (GRCm39) Q149K probably benign Het
Taf7l2 T C 10: 115,949,299 (GRCm39) S76G probably damaging Het
Thsd7a T C 6: 12,555,701 (GRCm39) D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 (GRCm39) probably benign Het
Tmem74 T C 15: 43,730,186 (GRCm39) T286A probably benign Het
Tnc T C 4: 63,938,705 (GRCm39) N45D probably benign Het
Trdmt1 T G 2: 13,528,225 (GRCm39) probably benign Het
Uty A T Y: 1,174,741 (GRCm39) Y220N probably damaging Het
Vdr T C 15: 97,757,002 (GRCm39) Y290C probably damaging Het
Vmn2r19 T A 6: 123,313,132 (GRCm39) M734K probably benign Het
Vps45 A G 3: 95,950,253 (GRCm39) probably benign Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12,334,835 (GRCm39) missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12,316,373 (GRCm39) missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12,315,656 (GRCm39) missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12,316,288 (GRCm39) missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12,315,872 (GRCm39) missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12,315,393 (GRCm39) unclassified probably benign
IGL03064:Vmn2r53 APN 7 12,334,937 (GRCm39) missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12,334,791 (GRCm39) missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12,340,435 (GRCm39) missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12,340,318 (GRCm39) missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12,315,819 (GRCm39) missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12,332,349 (GRCm39) missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12,315,993 (GRCm39) missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12,316,338 (GRCm39) missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12,315,707 (GRCm39) missense probably benign
R0881:Vmn2r53 UTSW 7 12,334,859 (GRCm39) missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12,335,141 (GRCm39) missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12,315,429 (GRCm39) missense probably benign
R1141:Vmn2r53 UTSW 7 12,334,673 (GRCm39) missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12,315,533 (GRCm39) missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12,318,701 (GRCm39) missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12,315,632 (GRCm39) missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12,334,812 (GRCm39) missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12,332,438 (GRCm39) missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12,335,366 (GRCm39) missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12,315,981 (GRCm39) missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12,315,656 (GRCm39) missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12,316,229 (GRCm39) missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12,315,932 (GRCm39) missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12,334,901 (GRCm39) missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4710:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4774:Vmn2r53 UTSW 7 12,334,692 (GRCm39) nonsense probably null
R4859:Vmn2r53 UTSW 7 12,335,330 (GRCm39) missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12,315,741 (GRCm39) missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12,335,347 (GRCm39) missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12,334,733 (GRCm39) missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12,316,328 (GRCm39) missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12,315,808 (GRCm39) missense probably benign
R6312:Vmn2r53 UTSW 7 12,332,566 (GRCm39) critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12,315,633 (GRCm39) missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12,335,360 (GRCm39) missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12,340,441 (GRCm39) missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12,335,069 (GRCm39) missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12,316,343 (GRCm39) missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12,315,513 (GRCm39) nonsense probably null
R7174:Vmn2r53 UTSW 7 12,315,628 (GRCm39) missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12,334,983 (GRCm39) missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12,340,359 (GRCm39) missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12,315,846 (GRCm39) missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12,332,425 (GRCm39) missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12,340,418 (GRCm39) missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12,316,026 (GRCm39) missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12,335,322 (GRCm39) missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12,315,843 (GRCm39) missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12,340,281 (GRCm39) missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12,315,737 (GRCm39) missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12,334,752 (GRCm39) missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12,315,926 (GRCm39) missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12,315,435 (GRCm39) missense probably benign
R9076:Vmn2r53 UTSW 7 12,340,231 (GRCm39) missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12,335,124 (GRCm39) missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12,315,912 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12,335,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCAAATACACCGGCCTAGTCC -3'
(R):5'- CTGCTGAGGCTATTTGCTGTAGTCC -3'

Sequencing Primer
(F):5'- ACCGGCCTAGTCCAGACC -3'
(R):5'- AGACCCTGTCCAGTGTTCAATATG -3'
Posted On 2014-01-05