Incidental Mutation 'R1102:Olfr376'
ID98195
Institutional Source Beutler Lab
Gene Symbol Olfr376
Ensembl Gene ENSMUSG00000063881
Gene Nameolfactory receptor 376
SynonymsGA_x6K02T2P1NL-3535075-3536028, MOR135-12
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73371246-73377836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73374874 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 45 (V45I)
Ref Sequence ENSEMBL: ENSMUSP00000077977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078952] [ENSMUST00000120401] [ENSMUST00000127789] [ENSMUST00000170592]
Predicted Effect probably benign
Transcript: ENSMUST00000078952
AA Change: V45I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077977
Gene: ENSMUSG00000063881
AA Change: V45I

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 7.4e-8 PFAM
Pfam:7tm_1 47 296 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120401
AA Change: V42I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113236
Gene: ENSMUSG00000063881
AA Change: V42I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116228
Gene: ENSMUSG00000072709
AA Change: V42I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 231 7.3e-8 PFAM
Pfam:7tm_1 44 240 2.5e-33 PFAM
Pfam:7tm_4 142 249 4.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170592
AA Change: V42I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126073
Gene: ENSMUSG00000063881
AA Change: V42I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Olfr376
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr376 APN 11 73375007 missense probably benign 0.03
IGL01462:Olfr376 APN 11 73374752 start codon destroyed probably null 0.02
IGL01725:Olfr376 APN 11 73375156 missense probably benign 0.39
IGL02225:Olfr376 APN 11 73375078 missense probably damaging 0.98
R0006:Olfr376 UTSW 11 73375588 missense possibly damaging 0.65
R0090:Olfr376 UTSW 11 73375576 missense probably benign 0.04
R0743:Olfr376 UTSW 11 73374889 missense probably benign 0.03
R0884:Olfr376 UTSW 11 73374889 missense probably benign 0.03
R1582:Olfr376 UTSW 11 73375264 missense probably damaging 1.00
R1765:Olfr376 UTSW 11 73375344 missense probably damaging 1.00
R1929:Olfr376 UTSW 11 73375601 missense probably damaging 1.00
R1941:Olfr376 UTSW 11 73375621 missense probably damaging 1.00
R4738:Olfr376 UTSW 11 73375350 missense possibly damaging 0.94
R4947:Olfr376 UTSW 11 73375417 nonsense probably null
R5837:Olfr376 UTSW 11 73375648 missense probably benign 0.02
R6440:Olfr376 UTSW 11 73375347 missense probably benign 0.06
R6736:Olfr376 UTSW 11 73375576 missense probably benign 0.18
R7254:Olfr376 UTSW 11 73375375 missense probably benign
R7354:Olfr376 UTSW 11 73375375 missense probably benign 0.01
R7437:Olfr376 UTSW 11 73375018 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCGATGGGAGTGCAGAGTCAATG -3'
(R):5'- GCAGATAGCCACATAGCGGTCATAG -3'

Sequencing Primer
(F):5'- CAGAGTCAATGGCACTGTTTC -3'
(R):5'- TACATTTGTGCCAGGCAGC -3'
Posted On2014-01-05