Incidental Mutation 'R1102:Mrc2'
ID98197
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105340821 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 820 (I820V)
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably benign
Transcript: ENSMUST00000021038
AA Change: I820V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: I820V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100335
AA Change: I820V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: I820V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151135
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATGACGATGATATCCGAGGCTGTG -3'
(R):5'- TGGCTTGCAAAGATAAACCTGGGAC -3'

Sequencing Primer
(F):5'- GTACCCATGCAGTGCCAG -3'
(R):5'- AGTGGGTGCTCAGTTCTAAC -3'
Posted On2014-01-05