Incidental Mutation 'R1102:Ssr1'
ID98202
Institutional Source Beutler Lab
Gene Symbol Ssr1
Ensembl Gene ENSMUSG00000021427
Gene Namesignal sequence receptor, alpha
SynonymsTRAPalpha, SSR
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location37966605-37994217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37987615 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 149 (Q149K)
Ref Sequence ENSEMBL: ENSMUSP00000152975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021864] [ENSMUST00000224399] [ENSMUST00000225246] [ENSMUST00000225319]
Predicted Effect probably benign
Transcript: ENSMUST00000021864
AA Change: Q149K

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021864
Gene: ENSMUSG00000021427
AA Change: Q149K

DomainStartEndE-ValueType
Pfam:TRAP_alpha 6 285 1.1e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224399
Predicted Effect probably benign
Transcript: ENSMUST00000225246
AA Change: Q149K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000225319
AA Change: Q149K

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality, subcutaneous edema, and cardiac defects, including absence of septation of the proximal part of the outflow tract, double outlet right ventricle, persistent truncus arteriosis, and abnormal development of the endocardial cushion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Ssr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Ssr1 APN 13 37983431 missense probably damaging 1.00
IGL02189:Ssr1 APN 13 37987516 critical splice donor site probably null
R1625:Ssr1 UTSW 13 37989503 critical splice donor site probably null
R2022:Ssr1 UTSW 13 37989549 missense probably damaging 0.96
R2055:Ssr1 UTSW 13 37987785 splice site probably benign
R4274:Ssr1 UTSW 13 37985290 missense possibly damaging 0.78
R6006:Ssr1 UTSW 13 37985996 frame shift probably null
R6659:Ssr1 UTSW 13 37987690 missense probably damaging 0.98
R6920:Ssr1 UTSW 13 37986022 missense probably damaging 1.00
R7034:Ssr1 UTSW 13 37994025 missense probably null
R7036:Ssr1 UTSW 13 37994025 missense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGCAGACTCTACTACTGCACAC -3'
(R):5'- GGCAAACAACATCGTGAAGTTCCTG -3'

Sequencing Primer
(F):5'- GAGACAGACAGGCAATTCCTTTTG -3'
(R):5'- CCTGGTTGGCTTTACAAACAAGG -3'
Posted On2014-01-05