Incidental Mutation 'R1102:Naip6'
ID98205
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100304415 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 286 (K286E)
Ref Sequence ENSEMBL: ENSMUSP00000112867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042220
AA Change: K286E

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: K286E

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118574
AA Change: K286E

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: K286E

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.3367 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100316475 missense probably benign 0.11
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4080:Naip6 UTSW 13 100299307 missense probably damaging 1.00
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4418:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5684:Naip6 UTSW 13 100300380 missense probably damaging 1.00
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100300600 missense probably benign 0.08
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7135:Naip6 UTSW 13 100300419 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
R7332:Naip6 UTSW 13 100300701 missense possibly damaging 0.62
R7339:Naip6 UTSW 13 100316019 missense probably damaging 1.00
R7353:Naip6 UTSW 13 100299751 missense probably benign 0.00
R7485:Naip6 UTSW 13 100283851 missense probably benign 0.07
R7597:Naip6 UTSW 13 100300600 missense probably benign 0.08
R7835:Naip6 UTSW 13 100316004 missense probably benign 0.19
R7840:Naip6 UTSW 13 100315471 missense probably damaging 1.00
R7918:Naip6 UTSW 13 100316004 missense probably benign 0.19
R7923:Naip6 UTSW 13 100315471 missense probably damaging 1.00
R8082:Naip6 UTSW 13 100300401 missense probably benign
R8082:Naip6 UTSW 13 100300453 missense probably benign
R8103:Naip6 UTSW 13 100301343 missense probably benign 0.00
R8164:Naip6 UTSW 13 100316289 missense probably benign 0.00
R8206:Naip6 UTSW 13 100294836 nonsense probably null
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Z1177:Naip6 UTSW 13 100299417 missense probably benign 0.20
Z1177:Naip6 UTSW 13 100300800 missense probably damaging 1.00
Z1177:Naip6 UTSW 13 100316130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACCCCAACTCTTTAAATGGGC -3'
(R):5'- TCCAACCACCTGCAAAGGTGATG -3'

Sequencing Primer
(F):5'- GGATATTGTCAGCCTAGACCTCAG -3'
(R):5'- TGAAAGCACAGGTCATCAGATTAC -3'
Posted On2014-01-05