Incidental Mutation 'R1102:Rfx3'
ID98225
Institutional Source Beutler Lab
Gene Symbol Rfx3
Ensembl Gene ENSMUSG00000040929
Gene Nameregulatory factor X, 3 (influences HLA class II expression)
SynonymsC230093O12Rik, MRFX3
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27761721-28011166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27867600 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 43 (V43A)
Ref Sequence ENSEMBL: ENSMUSP00000134700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046898] [ENSMUST00000165566] [ENSMUST00000172907] [ENSMUST00000173863] [ENSMUST00000174420] [ENSMUST00000174850]
Predicted Effect probably benign
Transcript: ENSMUST00000046898
AA Change: V43A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038760
Gene: ENSMUSG00000040929
AA Change: V43A

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 6.3e-58 PFAM
Pfam:RFX_DNA_binding 150 235 6.9e-41 PFAM
low complexity region 274 283 N/A INTRINSIC
internal_repeat_1 326 414 1.39e-5 PROSPERO
internal_repeat_1 439 527 1.39e-5 PROSPERO
low complexity region 649 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165566
AA Change: V43A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126313
Gene: ENSMUSG00000040929
AA Change: V43A

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 138 9.7e-38 PFAM
Pfam:RFX_DNA_binding 181 258 6.2e-36 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172907
AA Change: V43A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134141
Gene: ENSMUSG00000040929
AA Change: V43A

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173161
Predicted Effect probably benign
Transcript: ENSMUST00000173863
AA Change: V43A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133367
Gene: ENSMUSG00000040929
AA Change: V43A

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 3.3e-58 PFAM
Pfam:RFX_DNA_binding 175 246 3.7e-24 PFAM
low complexity region 285 294 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174420
AA Change: V43A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134700
Gene: ENSMUSG00000040929
AA Change: V43A

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 70 3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174850
AA Change: V43A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133461
Gene: ENSMUSG00000040929
AA Change: V43A

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Meta Mutation Damage Score 0.1390 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display embryonic and perinatal lethality, impaired development of cilia on the embryonic node, abnormal left-right patterning, meso- and dextrocardia, and situs inversus in surviving adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Rfx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Rfx3 APN 19 27806186 critical splice donor site probably null
IGL00588:Rfx3 APN 19 27826076 nonsense probably null
IGL01408:Rfx3 APN 19 27768650 missense probably benign 0.04
IGL01937:Rfx3 APN 19 27830729 missense probably damaging 1.00
IGL02668:Rfx3 APN 19 27815614 splice site probably benign
IGL02679:Rfx3 APN 19 27849737 missense possibly damaging 0.95
R0267:Rfx3 UTSW 19 27793788 missense probably benign 0.00
R0336:Rfx3 UTSW 19 27806262 missense probably benign 0.00
R0838:Rfx3 UTSW 19 27849967 missense possibly damaging 0.92
R0967:Rfx3 UTSW 19 27806351 splice site probably benign
R1507:Rfx3 UTSW 19 27768513 missense probably benign 0.00
R2172:Rfx3 UTSW 19 27815494 nonsense probably null
R2844:Rfx3 UTSW 19 27806786 splice site probably benign
R2960:Rfx3 UTSW 19 27900811 nonsense probably null
R4291:Rfx3 UTSW 19 27800232 missense probably damaging 1.00
R4952:Rfx3 UTSW 19 27830672 missense probably damaging 1.00
R5198:Rfx3 UTSW 19 27830776 missense probably damaging 1.00
R5451:Rfx3 UTSW 19 27849959 missense probably damaging 1.00
R5590:Rfx3 UTSW 19 27802380 critical splice donor site probably null
R5641:Rfx3 UTSW 19 27793608 splice site probably null
R5663:Rfx3 UTSW 19 27793617 missense probably damaging 1.00
R5899:Rfx3 UTSW 19 27830765 missense probably damaging 1.00
R6049:Rfx3 UTSW 19 27802395 missense probably damaging 0.99
R6368:Rfx3 UTSW 19 27768609 missense possibly damaging 0.92
R7131:Rfx3 UTSW 19 27768628 nonsense probably null
R7273:Rfx3 UTSW 19 27802458 missense probably damaging 1.00
R7593:Rfx3 UTSW 19 27849739 missense probably benign 0.00
R7814:Rfx3 UTSW 19 27826070 missense probably benign 0.01
R7815:Rfx3 UTSW 19 27826048 missense probably benign 0.00
R8458:Rfx3 UTSW 19 27793672 missense possibly damaging 0.71
Z1088:Rfx3 UTSW 19 27837450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGGAAATTGCTAAGGCACAC -3'
(R):5'- ACCACTTACCATGAACCTAATGCAATGT -3'

Sequencing Primer
(F):5'- TGCTAAGGCACACACAATTTG -3'
(R):5'- AGGCTTTTAAGGTCTACTAACCC -3'
Posted On2014-01-05