Incidental Mutation 'R1102:AU022751'
List |< first << previous [record 60 of 1113] next >> last >|
ID98227
Institutional Source Beutler Lab
Gene Symbol AU022751
Ensembl Gene ENSMUSG00000073294
Gene Nameexpressed sequence AU022751
Synonyms
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.026) question?
Stock #R1102 (G1)
Quality Score214
Status Validated
ChromosomeX
Chromosomal Location6081219-6083419 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GTCATCATCATCATC to GTCATCATCATCATCATC at 6082591 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101698] [ENSMUST00000117544]
Predicted Effect probably benign
Transcript: ENSMUST00000101698
SMART Domains Protein: ENSMUSP00000099222
Gene: ENSMUSG00000073294

DomainStartEndE-ValueType
low complexity region 19 42 N/A INTRINSIC
low complexity region 113 134 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
low complexity region 252 292 N/A INTRINSIC
low complexity region 314 344 N/A INTRINSIC
low complexity region 388 407 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117544
SMART Domains Protein: ENSMUSP00000114041
Gene: ENSMUSG00000073294

DomainStartEndE-ValueType
low complexity region 19 42 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 347 363 N/A INTRINSIC
low complexity region 373 413 N/A INTRINSIC
low complexity region 435 465 N/A INTRINSIC
low complexity region 509 528 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181123
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in AU022751
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1015:AU022751 UTSW X 6082591 small insertion probably benign
R1513:AU022751 UTSW X 6082591 small insertion probably benign
R1885:AU022751 UTSW X 6082591 small insertion probably benign
R1886:AU022751 UTSW X 6082591 small insertion probably benign
R1887:AU022751 UTSW X 6082591 small insertion probably benign
R1931:AU022751 UTSW X 6082763 missense probably benign 0.07
R1996:AU022751 UTSW X 6082591 small insertion probably benign
R2255:AU022751 UTSW X 6082700 missense probably benign 0.03
R3857:AU022751 UTSW X 6082656 missense possibly damaging 0.83
R3859:AU022751 UTSW X 6082656 missense possibly damaging 0.83
X0018:AU022751 UTSW X 6081975 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGACGTAAATTCCAGCCTGTGC -3'
(R):5'- TGGACATGCAAGGCCCATGATGAG -3'

Sequencing Primer
(F):5'- AAAGGTACAACTCCGGAACG -3'
(R):5'- AGCCAGAGTCTTCTCTGAGC -3'
Posted On2014-01-05