Mutagenetix > Incidental Mutations

Incidental Mutation 'R1103:Lrrc7'

98246

Institutional Source

Beutler Lab

Gene Symbol

Lrrc7

Ensembl Gene

ENSMUSG00000028176

Gene Name

leucine rich repeat containing 7

Synonyms

densin

MMRRC Submission

039176-MU

Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene?

Probably essential (E-score: 0.777) question?

Stock #

R1103 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158082891-158562221 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 158148706 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]

Predicted Effect

probably benign
Transcript: ENSMUST00000106044

SMART Domains

Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1349	1378	2e-11	BLAST
PDZ	1460	1540	1.33e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199890

SMART Domains

Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	9e-6	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1328	1364	1e-15	BLAST
low complexity region	1374	1387	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200137

SMART Domains

Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176

Domain	Start	End	E-Value	Type
LRR	52	69	7.6e-1	SMART
LRR	73	92	4.2e-1	SMART
LRR	96	115	3.4e-1	SMART
LRR	142	164	1.8e-1	SMART
LRR	165	184	1.5e-1	SMART
LRR	188	207	2e-2	SMART
LRR	211	233	1.3e-1	SMART
LRR	234	257	1.7e-1	SMART
LRR	257	276	1e0	SMART
LRR	280	299	3.1e-2	SMART
LRR	303	322	6.6e-1	SMART
LRR	326	345	2.1e-1	SMART
LRR	372	391	1.2e-1	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1302	1331	2e-11	BLAST
PDZ	1413	1493	6.4e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200196

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.7%

Validation Efficiency

97% (60/62)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
4930524J08Rik	G	A	5: 99,979,121		probably benign	Het
4932438A13Rik	A	T	3: 36,996,523	M3003L	probably benign	Het
9530053A07Rik	G	T	7: 28,154,520	L1636F	probably damaging	Het
Adam3	T	A	8: 24,714,271		probably benign	Het
Adpgk	A	G	9: 59,313,796	H295R	probably damaging	Het
Aftph	A	T	11: 20,726,547	M199K	probably benign	Het
Ap2a1	C	A	7: 44,904,169		probably benign	Het
Atpaf2	T	C	11: 60,403,950	I216V	probably benign	Het
Bag4	A	T	8: 25,767,863		probably benign	Het
Bud23	T	C	5: 135,061,139	S67G	probably damaging	Het
Cfap157	A	G	2: 32,781,398	F132S	probably damaging	Het
Cngb3	G	A	4: 19,309,658		probably null	Het
Cntnap5a	A	G	1: 116,580,669	I1304V	possibly damaging	Het
Cp	A	G	3: 19,981,985	K764E	possibly damaging	Het
Crebbp	A	G	16: 4,084,061	V2438A	probably damaging	Het
Csmd3	A	T	15: 47,948,006	W1230R	probably damaging	Het
Cul1	G	A	6: 47,517,177	V475I	probably benign	Het
Dnttip2	T	C	3: 122,276,422	S429P	probably benign	Het
Dtwd1	T	C	2: 126,154,723	S43P	probably damaging	Het
Ect2l	T	C	10: 18,140,526	T705A	probably damaging	Het
Erbin	G	T	13: 103,886,202	T43N	probably benign	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Gm13088	A	C	4: 143,655,372	C251W	probably damaging	Het
Gpr150	G	T	13: 76,055,593	P411Q	probably damaging	Het
Grap	C	A	11: 61,671,718	Q172K	probably benign	Het
Ido2	G	A	8: 24,576,223	T9M	probably benign	Het
Klkb1	C	A	8: 45,276,146	C347F	probably damaging	Het
Klra17	G	A	6: 129,868,843		probably benign	Het
Lama1	T	C	17: 67,790,947	L1774P	probably damaging	Het
Lhpp	A	T	7: 132,610,755	D17V	probably damaging	Het
Lrfn4	T	C	19: 4,613,271	T412A	probably benign	Het
Ltbp3	A	T	19: 5,747,411		probably null	Het
Ltbp3	G	C	19: 5,747,412		probably null	Het
Luzp1	T	A	4: 136,540,730	L88Q	possibly damaging	Het
Magi2	T	C	5: 20,611,103	I747T	probably damaging	Het
Map1b	A	T	13: 99,427,466		probably benign	Het
Map3k4	A	T	17: 12,237,063		probably null	Het
Map3k5	C	A	10: 20,023,676	D226E	probably benign	Het
Mtf1	T	A	4: 124,838,468	S440T	probably benign	Het
Myo18a	T	A	11: 77,823,330	L389Q	probably damaging	Het
Myom2	A	G	8: 15,110,827	D900G	probably benign	Het
Nfasc	T	C	1: 132,607,057		probably benign	Het
Obscn	A	T	11: 59,021,483	S7044R	probably damaging	Het
Olfr1350	T	A	7: 6,570,112	N40K	probably damaging	Het
Olfr424	T	C	1: 174,136,891	V49A	probably benign	Het
Olfr513	T	C	7: 108,754,883	V9A	possibly damaging	Het
Pde4c	T	A	8: 70,748,417	H421Q	probably damaging	Het
Pnmt	G	T	11: 98,387,676	R156L	probably benign	Het
Rnf138	A	G	18: 21,026,102	E193G	probably damaging	Het
Sesn1	G	T	10: 41,902,593	R346L	possibly damaging	Het
Setd4	G	T	16: 93,585,194	H390Q	probably benign	Het
Supt6	T	C	11: 78,225,473	E688G	possibly damaging	Het
Syne2	G	A	12: 76,109,835	D6802N	probably benign	Het
Syt16	A	G	12: 74,266,898	K533E	probably damaging	Het
Tg	A	T	15: 66,719,655	Q26H	probably benign	Het
Trim33	G	T	3: 103,310,885	W250L	probably damaging	Het
Trip4	A	G	9: 65,880,906	C86R	probably benign	Het
Upf2	T	A	2: 6,026,175	C809S	unknown	Het
Vrk2	A	G	11: 26,549,325	F76L	probably damaging	Het
Zfp804a	A	G	2: 82,257,500	T558A	probably damaging	Het

Other mutations in Lrrc7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Lrrc7	APN	3	158187010	missense	probably benign	0.07
IGL00644:Lrrc7	APN	3	158202368	nonsense	probably null
IGL00822:Lrrc7	APN	3	158185474	missense	probably damaging	0.99
IGL00927:Lrrc7	APN	3	158161090	missense	possibly damaging	0.94
IGL00946:Lrrc7	APN	3	158161356	missense	probably benign	0.07
IGL00948:Lrrc7	APN	3	158161557	missense	probably damaging	1.00
IGL01838:Lrrc7	APN	3	158185463	missense	probably damaging	1.00
IGL01874:Lrrc7	APN	3	158240443	splice site	probably benign
IGL02514:Lrrc7	APN	3	158160292	missense	probably damaging	0.96
IGL02545:Lrrc7	APN	3	158185374	splice site	probably benign
IGL02665:Lrrc7	APN	3	158161105	missense	probably damaging	0.99
IGL03129:Lrrc7	APN	3	158161059	missense	probably benign	0.02
N/A:Lrrc7	UTSW	3	158160340	missense	probably benign
R0021:Lrrc7	UTSW	3	158160661	missense	probably damaging	1.00
R0041:Lrrc7	UTSW	3	158164260	splice site	probably benign
R0255:Lrrc7	UTSW	3	158160838	nonsense	probably null
R0278:Lrrc7	UTSW	3	158179795	missense	possibly damaging	0.96
R0409:Lrrc7	UTSW	3	158161426	missense	possibly damaging	0.59
R0612:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R0866:Lrrc7	UTSW	3	158164266	splice site	probably benign
R1077:Lrrc7	UTSW	3	158161143	missense	probably damaging	1.00
R1157:Lrrc7	UTSW	3	158160255	missense	probably damaging	1.00
R1187:Lrrc7	UTSW	3	158160402	missense	probably damaging	1.00
R1301:Lrrc7	UTSW	3	158135331	missense	probably benign	0.20
R1433:Lrrc7	UTSW	3	158177306	missense	probably damaging	1.00
R1450:Lrrc7	UTSW	3	158187044	missense	possibly damaging	0.62
R1595:Lrrc7	UTSW	3	158177277	nonsense	probably null
R1659:Lrrc7	UTSW	3	158161408	missense	probably damaging	1.00
R1693:Lrrc7	UTSW	3	158084533	missense	possibly damaging	0.95
R1774:Lrrc7	UTSW	3	158160292	missense	possibly damaging	0.88
R2273:Lrrc7	UTSW	3	158187059	missense	probably damaging	1.00
R2276:Lrrc7	UTSW	3	158179792	missense	probably damaging	1.00
R2302:Lrrc7	UTSW	3	158135244	missense	probably damaging	0.99
R2326:Lrrc7	UTSW	3	158170661	missense	probably damaging	1.00
R2371:Lrrc7	UTSW	3	158161060	missense	probably damaging	0.99
R2383:Lrrc7	UTSW	3	158163956	missense	probably benign
R2679:Lrrc7	UTSW	3	158175108	nonsense	probably null
R2698:Lrrc7	UTSW	3	158135391	missense	probably benign	0.22
R2858:Lrrc7	UTSW	3	158161725	missense	probably damaging	0.99
R3758:Lrrc7	UTSW	3	158163965	missense	probably damaging	1.00
R3791:Lrrc7	UTSW	3	158163956	missense	probably benign
R3805:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3806:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3807:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3892:Lrrc7	UTSW	3	158160696	missense	probably benign	0.08
R3912:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3913:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3963:Lrrc7	UTSW	3	158160405	missense	probably damaging	1.00
R4665:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4666:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4671:Lrrc7	UTSW	3	158202495	critical splice acceptor site	probably null
R4688:Lrrc7	UTSW	3	158148605	missense	probably damaging	1.00
R4725:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4726:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4728:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4783:Lrrc7	UTSW	3	158127213	critical splice donor site	probably null
R4867:Lrrc7	UTSW	3	158161005	missense	probably damaging	1.00
R4907:Lrrc7	UTSW	3	158161240	missense	probably damaging	1.00
R5032:Lrrc7	UTSW	3	158181580	missense	possibly damaging	0.85
R5107:Lrrc7	UTSW	3	158161896	missense	probably damaging	1.00
R5295:Lrrc7	UTSW	3	158170739	missense	probably damaging	1.00
R5348:Lrrc7	UTSW	3	158175326	missense	probably benign	0.02
R5468:Lrrc7	UTSW	3	158318436	missense	probably damaging	1.00
R5778:Lrrc7	UTSW	3	158170743	missense	probably damaging	1.00
R5897:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R6179:Lrrc7	UTSW	3	158353432	missense	probably damaging	0.99
R6312:Lrrc7	UTSW	3	158160609	missense	probably benign	0.04
R6313:Lrrc7	UTSW	3	158160736	missense	probably damaging	1.00
R6366:Lrrc7	UTSW	3	158135375	missense	probably benign	0.04
R6389:Lrrc7	UTSW	3	158185426	missense	probably damaging	1.00
R6638:Lrrc7	UTSW	3	158135303	missense	probably benign	0.20
R6956:Lrrc7	UTSW	3	158289031	missense	probably benign	0.02
R6969:Lrrc7	UTSW	3	158156913	missense	probably benign	0.19
R7073:Lrrc7	UTSW	3	158127247	missense	probably damaging	1.00
R7313:Lrrc7	UTSW	3	158160474	missense	probably damaging	1.00
R7365:Lrrc7	UTSW	3	158198161	missense	probably damaging	1.00
R7398:Lrrc7	UTSW	3	158291958	nonsense	probably null
R7403:Lrrc7	UTSW	3	158148674	nonsense	probably null
R7407:Lrrc7	UTSW	3	158135241	missense	probably damaging	1.00
R7427:Lrrc7	UTSW	3	158198141	missense	probably benign	0.06
R7453:Lrrc7	UTSW	3	158185409	missense	probably benign	0.00
R7461:Lrrc7	UTSW	3	158187020	missense	probably benign	0.00
R7807:Lrrc7	UTSW	3	158160487	missense	probably damaging	1.00
R7872:Lrrc7	UTSW	3	158353462	missense	probably damaging	0.99
R8215:Lrrc7	UTSW	3	158209750	missense	probably benign
R8367:Lrrc7	UTSW	3	158202370	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AGTTGACCAGAAGCCCTTGAATGTC -3'
(R):5'- AGTGCCAAGCATCTTCATCTGCC -3'

Sequencing Primer
(F):5'- GCCCTTGAATGTCAGGATTATTTAGC -3'
(R):5'- AGTGCTGATCCTGCCAAG -3'

Posted On

2014-01-05