Incidental Mutation 'R1103:Lrrc7'
ID98246
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Nameleucine rich repeat containing 7
Synonymsdensin
MMRRC Submission 039176-MU
Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R1103 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location158082891-158562221 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 158148706 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
Predicted Effect probably benign
Transcript: ENSMUST00000106044
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199890
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200137
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200196
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930524J08Rik G A 5: 99,979,121 probably benign Het
4932438A13Rik A T 3: 36,996,523 M3003L probably benign Het
9530053A07Rik G T 7: 28,154,520 L1636F probably damaging Het
Adam3 T A 8: 24,714,271 probably benign Het
Adpgk A G 9: 59,313,796 H295R probably damaging Het
Aftph A T 11: 20,726,547 M199K probably benign Het
Ap2a1 C A 7: 44,904,169 probably benign Het
Atpaf2 T C 11: 60,403,950 I216V probably benign Het
Bag4 A T 8: 25,767,863 probably benign Het
Bud23 T C 5: 135,061,139 S67G probably damaging Het
Cfap157 A G 2: 32,781,398 F132S probably damaging Het
Cngb3 G A 4: 19,309,658 probably null Het
Cntnap5a A G 1: 116,580,669 I1304V possibly damaging Het
Cp A G 3: 19,981,985 K764E possibly damaging Het
Crebbp A G 16: 4,084,061 V2438A probably damaging Het
Csmd3 A T 15: 47,948,006 W1230R probably damaging Het
Cul1 G A 6: 47,517,177 V475I probably benign Het
Dnttip2 T C 3: 122,276,422 S429P probably benign Het
Dtwd1 T C 2: 126,154,723 S43P probably damaging Het
Ect2l T C 10: 18,140,526 T705A probably damaging Het
Erbin G T 13: 103,886,202 T43N probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm13088 A C 4: 143,655,372 C251W probably damaging Het
Gpr150 G T 13: 76,055,593 P411Q probably damaging Het
Grap C A 11: 61,671,718 Q172K probably benign Het
Ido2 G A 8: 24,576,223 T9M probably benign Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Klra17 G A 6: 129,868,843 probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lhpp A T 7: 132,610,755 D17V probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Ltbp3 A T 19: 5,747,411 probably null Het
Ltbp3 G C 19: 5,747,412 probably null Het
Luzp1 T A 4: 136,540,730 L88Q possibly damaging Het
Magi2 T C 5: 20,611,103 I747T probably damaging Het
Map1b A T 13: 99,427,466 probably benign Het
Map3k4 A T 17: 12,237,063 probably null Het
Map3k5 C A 10: 20,023,676 D226E probably benign Het
Mtf1 T A 4: 124,838,468 S440T probably benign Het
Myo18a T A 11: 77,823,330 L389Q probably damaging Het
Myom2 A G 8: 15,110,827 D900G probably benign Het
Nfasc T C 1: 132,607,057 probably benign Het
Obscn A T 11: 59,021,483 S7044R probably damaging Het
Olfr1350 T A 7: 6,570,112 N40K probably damaging Het
Olfr424 T C 1: 174,136,891 V49A probably benign Het
Olfr513 T C 7: 108,754,883 V9A possibly damaging Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Sesn1 G T 10: 41,902,593 R346L possibly damaging Het
Setd4 G T 16: 93,585,194 H390Q probably benign Het
Supt6 T C 11: 78,225,473 E688G possibly damaging Het
Syne2 G A 12: 76,109,835 D6802N probably benign Het
Syt16 A G 12: 74,266,898 K533E probably damaging Het
Tg A T 15: 66,719,655 Q26H probably benign Het
Trim33 G T 3: 103,310,885 W250L probably damaging Het
Trip4 A G 9: 65,880,906 C86R probably benign Het
Upf2 T A 2: 6,026,175 C809S unknown Het
Vrk2 A G 11: 26,549,325 F76L probably damaging Het
Zfp804a A G 2: 82,257,500 T558A probably damaging Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 158187010 missense probably benign 0.07
IGL00644:Lrrc7 APN 3 158202368 nonsense probably null
IGL00822:Lrrc7 APN 3 158185474 missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 158161090 missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 158161356 missense probably benign 0.07
IGL00948:Lrrc7 APN 3 158161557 missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 158185463 missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 158240443 splice site probably benign
IGL02514:Lrrc7 APN 3 158160292 missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 158185374 splice site probably benign
IGL02665:Lrrc7 APN 3 158161105 missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 158161059 missense probably benign 0.02
N/A:Lrrc7 UTSW 3 158160340 missense probably benign
R0021:Lrrc7 UTSW 3 158160661 missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 158164260 splice site probably benign
R0255:Lrrc7 UTSW 3 158160838 nonsense probably null
R0278:Lrrc7 UTSW 3 158179795 missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 158161426 missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 158164266 splice site probably benign
R1077:Lrrc7 UTSW 3 158161143 missense probably damaging 1.00
R1157:Lrrc7 UTSW 3 158160255 missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 158160402 missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 158135331 missense probably benign 0.20
R1433:Lrrc7 UTSW 3 158177306 missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 158187044 missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 158177277 nonsense probably null
R1659:Lrrc7 UTSW 3 158161408 missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 158084533 missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 158160292 missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 158187059 missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 158179792 missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 158135244 missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 158170661 missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 158161060 missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 158163956 missense probably benign
R2679:Lrrc7 UTSW 3 158175108 nonsense probably null
R2698:Lrrc7 UTSW 3 158135391 missense probably benign 0.22
R2858:Lrrc7 UTSW 3 158161725 missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 158163965 missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 158163956 missense probably benign
R3805:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3806:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3807:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3892:Lrrc7 UTSW 3 158160696 missense probably benign 0.08
R3912:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 158160405 missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 158202495 critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 158148605 missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 158127213 critical splice donor site probably null
R4867:Lrrc7 UTSW 3 158161005 missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 158161240 missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 158181580 missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 158161896 missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 158170739 missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 158175326 missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158318436 missense probably damaging 1.00
R5778:Lrrc7 UTSW 3 158170743 missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158353432 missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 158160609 missense probably benign 0.04
R6313:Lrrc7 UTSW 3 158160736 missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 158135375 missense probably benign 0.04
R6389:Lrrc7 UTSW 3 158185426 missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 158135303 missense probably benign 0.20
R6956:Lrrc7 UTSW 3 158289031 missense probably benign 0.02
R6969:Lrrc7 UTSW 3 158156913 missense probably benign 0.19
R7073:Lrrc7 UTSW 3 158127247 missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 158160474 missense probably damaging 1.00
R7365:Lrrc7 UTSW 3 158198161 missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 158291958 nonsense probably null
R7403:Lrrc7 UTSW 3 158148674 nonsense probably null
R7407:Lrrc7 UTSW 3 158135241 missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 158198141 missense probably benign 0.06
R7453:Lrrc7 UTSW 3 158185409 missense probably benign 0.00
R7461:Lrrc7 UTSW 3 158187020 missense probably benign 0.00
R7807:Lrrc7 UTSW 3 158160487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGACCAGAAGCCCTTGAATGTC -3'
(R):5'- AGTGCCAAGCATCTTCATCTGCC -3'

Sequencing Primer
(F):5'- GCCCTTGAATGTCAGGATTATTTAGC -3'
(R):5'- AGTGCTGATCCTGCCAAG -3'
Posted On2014-01-05