Incidental Mutation 'R1103:Magi2'
ID98252
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 2
SynonymsMagi-2, S-SCAM, Acvrinp1
MMRRC Submission 039176-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1103 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location19227036-20704792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20611103 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 747 (I747T)
Ref Sequence ENSEMBL: ENSMUSP00000146458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000101558] [ENSMUST00000115267] [ENSMUST00000197354] [ENSMUST00000197443] [ENSMUST00000197553] [ENSMUST00000208219]
Predicted Effect probably damaging
Transcript: ENSMUST00000088516
AA Change: I1153T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003
AA Change: I1153T

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101558
AA Change: I976T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099094
Gene: ENSMUSG00000040003
AA Change: I976T

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 608 684 4.04e-19 SMART
low complexity region 716 730 N/A INTRINSIC
PDZ 751 832 5.05e-20 SMART
low complexity region 875 886 N/A INTRINSIC
PDZ 970 1044 3.88e-21 SMART
low complexity region 1080 1093 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115267
AA Change: I990T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110922
Gene: ENSMUSG00000040003
AA Change: I990T

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 622 698 4.04e-19 SMART
low complexity region 730 744 N/A INTRINSIC
PDZ 765 846 5.05e-20 SMART
low complexity region 889 900 N/A INTRINSIC
PDZ 984 1058 3.88e-21 SMART
low complexity region 1094 1107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197354
AA Change: I1153T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003
AA Change: I1153T

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197443
AA Change: I1139T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003
AA Change: I1139T

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197553
AA Change: I763T

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect unknown
Transcript: ENSMUST00000199514
AA Change: I93T
Predicted Effect probably damaging
Transcript: ENSMUST00000208219
AA Change: I747T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8826 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930524J08Rik G A 5: 99,979,121 probably benign Het
4932438A13Rik A T 3: 36,996,523 M3003L probably benign Het
9530053A07Rik G T 7: 28,154,520 L1636F probably damaging Het
Adam3 T A 8: 24,714,271 probably benign Het
Adpgk A G 9: 59,313,796 H295R probably damaging Het
Aftph A T 11: 20,726,547 M199K probably benign Het
Ap2a1 C A 7: 44,904,169 probably benign Het
Atpaf2 T C 11: 60,403,950 I216V probably benign Het
Bag4 A T 8: 25,767,863 probably benign Het
Bud23 T C 5: 135,061,139 S67G probably damaging Het
Cfap157 A G 2: 32,781,398 F132S probably damaging Het
Cngb3 G A 4: 19,309,658 probably null Het
Cntnap5a A G 1: 116,580,669 I1304V possibly damaging Het
Cp A G 3: 19,981,985 K764E possibly damaging Het
Crebbp A G 16: 4,084,061 V2438A probably damaging Het
Csmd3 A T 15: 47,948,006 W1230R probably damaging Het
Cul1 G A 6: 47,517,177 V475I probably benign Het
Dnttip2 T C 3: 122,276,422 S429P probably benign Het
Dtwd1 T C 2: 126,154,723 S43P probably damaging Het
Ect2l T C 10: 18,140,526 T705A probably damaging Het
Erbin G T 13: 103,886,202 T43N probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm13088 A C 4: 143,655,372 C251W probably damaging Het
Gpr150 G T 13: 76,055,593 P411Q probably damaging Het
Grap C A 11: 61,671,718 Q172K probably benign Het
Ido2 G A 8: 24,576,223 T9M probably benign Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Klra17 G A 6: 129,868,843 probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lhpp A T 7: 132,610,755 D17V probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Lrrc7 C T 3: 158,148,706 probably benign Het
Ltbp3 A T 19: 5,747,411 probably null Het
Ltbp3 G C 19: 5,747,412 probably null Het
Luzp1 T A 4: 136,540,730 L88Q possibly damaging Het
Map1b A T 13: 99,427,466 probably benign Het
Map3k4 A T 17: 12,237,063 probably null Het
Map3k5 C A 10: 20,023,676 D226E probably benign Het
Mtf1 T A 4: 124,838,468 S440T probably benign Het
Myo18a T A 11: 77,823,330 L389Q probably damaging Het
Myom2 A G 8: 15,110,827 D900G probably benign Het
Nfasc T C 1: 132,607,057 probably benign Het
Obscn A T 11: 59,021,483 S7044R probably damaging Het
Olfr1350 T A 7: 6,570,112 N40K probably damaging Het
Olfr424 T C 1: 174,136,891 V49A probably benign Het
Olfr513 T C 7: 108,754,883 V9A possibly damaging Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Sesn1 G T 10: 41,902,593 R346L possibly damaging Het
Setd4 G T 16: 93,585,194 H390Q probably benign Het
Supt6 T C 11: 78,225,473 E688G possibly damaging Het
Syne2 G A 12: 76,109,835 D6802N probably benign Het
Syt16 A G 12: 74,266,898 K533E probably damaging Het
Tg A T 15: 66,719,655 Q26H probably benign Het
Trim33 G T 3: 103,310,885 W250L probably damaging Het
Trip4 A G 9: 65,880,906 C86R probably benign Het
Upf2 T A 2: 6,026,175 C809S unknown Het
Vrk2 A G 11: 26,549,325 F76L probably damaging Het
Zfp804a A G 2: 82,257,500 T558A probably damaging Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20391301 missense probably benign 0.05
IGL02120:Magi2 APN 5 20228453 critical splice donor site probably null
IGL02341:Magi2 APN 5 20466203 missense probably damaging 1.00
IGL02411:Magi2 APN 5 19678709 missense probably damaging 1.00
IGL02657:Magi2 APN 5 19227583 missense probably damaging 0.99
IGL02976:Magi2 APN 5 20534475 missense probably damaging 1.00
IGL03105:Magi2 APN 5 20543618 missense probably damaging 0.97
IGL03246:Magi2 APN 5 20358950 missense probably damaging 1.00
IGL03329:Magi2 APN 5 20466128 missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 19954511 intron probably benign
PIT4519001:Magi2 UTSW 5 20661346 missense probably damaging 1.00
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0352:Magi2 UTSW 5 20065666 missense probably damaging 1.00
R0362:Magi2 UTSW 5 19227575 missense probably damaging 1.00
R0496:Magi2 UTSW 5 20661359 splice site probably benign
R1435:Magi2 UTSW 5 20358945 missense probably damaging 1.00
R1583:Magi2 UTSW 5 19227332 missense probably benign 0.30
R1616:Magi2 UTSW 5 20609326 missense probably damaging 1.00
R1643:Magi2 UTSW 5 20705506 unclassified probably benign
R1707:Magi2 UTSW 5 20215493 missense probably damaging 1.00
R1833:Magi2 UTSW 5 19227457 missense probably damaging 1.00
R1837:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1838:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1839:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1847:Magi2 UTSW 5 20602460 missense probably damaging 0.99
R2223:Magi2 UTSW 5 20465672 missense probably damaging 1.00
R2496:Magi2 UTSW 5 19678752 missense probably benign 0.42
R2504:Magi2 UTSW 5 20358936 missense probably damaging 1.00
R2848:Magi2 UTSW 5 20602461 frame shift probably null
R2879:Magi2 UTSW 5 20602461 frame shift probably null
R2935:Magi2 UTSW 5 20602461 frame shift probably null
R2936:Magi2 UTSW 5 20602461 frame shift probably null
R3694:Magi2 UTSW 5 20602461 frame shift probably null
R3783:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3786:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3787:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3837:Magi2 UTSW 5 20215468 missense probably benign 0.28
R4151:Magi2 UTSW 5 19227292 missense probably damaging 0.97
R4721:Magi2 UTSW 5 20534469 missense probably damaging 1.00
R5005:Magi2 UTSW 5 20534446 missense probably damaging 0.98
R5012:Magi2 UTSW 5 20465620 missense probably damaging 0.99
R5193:Magi2 UTSW 5 20358972 critical splice donor site probably null
R5298:Magi2 UTSW 5 20569162 missense probably damaging 1.00
R5372:Magi2 UTSW 5 20702110 missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20215424 missense probably benign 0.03
R5806:Magi2 UTSW 5 20651204 missense probably benign 0.01
R5924:Magi2 UTSW 5 20611069 missense probably benign 0.00
R5992:Magi2 UTSW 5 19227291 start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20611093 missense probably damaging 1.00
R6073:Magi2 UTSW 5 20569288 missense probably damaging 1.00
R6500:Magi2 UTSW 5 20602347 missense possibly damaging 0.94
R6664:Magi2 UTSW 5 20702397 missense probably benign 0.00
R7229:Magi2 UTSW 5 20465588 missense probably damaging 1.00
R7344:Magi2 UTSW 5 20550240 missense probably benign 0.19
R7448:Magi2 UTSW 5 20358956 missense probably damaging 1.00
R7605:Magi2 UTSW 5 20228385 missense probably damaging 1.00
R7712:Magi2 UTSW 5 20550282 missense possibly damaging 0.78
R7808:Magi2 UTSW 5 20465840 missense probably benign 0.03
X0065:Magi2 UTSW 5 20569178 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGACCTACTTGAGCCTTTGGAGC -3'
(R):5'- TTGTCTGAGAGCACGCCTTAGCATC -3'

Sequencing Primer
(F):5'- AGGAGGCATTTCAGCACCTTG -3'
(R):5'- TTAGCATCTTCCTAACACCACAATG -3'
Posted On2014-01-05