Incidental Mutation 'R1103:Cul1'
ID 98258
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Name cullin 1
Synonyms
MMRRC Submission 039176-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1103 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 47430516-47503078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47494111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 475 (V475I)
Ref Sequence ENSEMBL: ENSMUSP00000122702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200]
AlphaFold Q9WTX6
Predicted Effect probably benign
Transcript: ENSMUST00000031697
AA Change: V475I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686
AA Change: V475I

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126877
Predicted Effect probably benign
Transcript: ENSMUST00000146200
AA Change: V475I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686
AA Change: V475I

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154201
Meta Mutation Damage Score 0.0800 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
4930524J08Rik G A 5: 100,126,980 (GRCm39) probably benign Het
Adam3 T A 8: 25,204,287 (GRCm39) probably benign Het
Adpgk A G 9: 59,221,079 (GRCm39) H295R probably damaging Het
Aftph A T 11: 20,676,547 (GRCm39) M199K probably benign Het
Ap2a1 C A 7: 44,553,593 (GRCm39) probably benign Het
Atpaf2 T C 11: 60,294,776 (GRCm39) I216V probably benign Het
Bag4 A T 8: 26,257,891 (GRCm39) probably benign Het
Bltp1 A T 3: 37,050,672 (GRCm39) M3003L probably benign Het
Bud23 T C 5: 135,089,993 (GRCm39) S67G probably damaging Het
Cfap157 A G 2: 32,671,410 (GRCm39) F132S probably damaging Het
Cngb3 G A 4: 19,309,658 (GRCm39) probably null Het
Cntnap5a A G 1: 116,508,399 (GRCm39) I1304V possibly damaging Het
Cp A G 3: 20,036,149 (GRCm39) K764E possibly damaging Het
Crebbp A G 16: 3,901,925 (GRCm39) V2438A probably damaging Het
Csmd3 A T 15: 47,811,402 (GRCm39) W1230R probably damaging Het
Dnttip2 T C 3: 122,070,071 (GRCm39) S429P probably benign Het
Dtwd1 T C 2: 125,996,643 (GRCm39) S43P probably damaging Het
Ect2l T C 10: 18,016,274 (GRCm39) T705A probably damaging Het
Erbin G T 13: 104,022,710 (GRCm39) T43N probably benign Het
Fcgbpl1 G T 7: 27,853,945 (GRCm39) L1636F probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Gpr150 G T 13: 76,203,712 (GRCm39) P411Q probably damaging Het
Grap C A 11: 61,562,544 (GRCm39) Q172K probably benign Het
Ido2 G A 8: 25,066,239 (GRCm39) T9M probably benign Het
Klkb1 C A 8: 45,729,183 (GRCm39) C347F probably damaging Het
Klra17 G A 6: 129,845,806 (GRCm39) probably benign Het
Lama1 T C 17: 68,097,942 (GRCm39) L1774P probably damaging Het
Lhpp A T 7: 132,212,484 (GRCm39) D17V probably damaging Het
Lrfn4 T C 19: 4,663,299 (GRCm39) T412A probably benign Het
Lrrc7 C T 3: 157,854,343 (GRCm39) probably benign Het
Ltbp3 A T 19: 5,797,439 (GRCm39) probably null Het
Ltbp3 G C 19: 5,797,440 (GRCm39) probably null Het
Luzp1 T A 4: 136,268,041 (GRCm39) L88Q possibly damaging Het
Magi2 T C 5: 20,816,101 (GRCm39) I747T probably damaging Het
Map1b A T 13: 99,563,974 (GRCm39) probably benign Het
Map3k4 A T 17: 12,455,950 (GRCm39) probably null Het
Map3k5 C A 10: 19,899,422 (GRCm39) D226E probably benign Het
Mtf1 T A 4: 124,732,261 (GRCm39) S440T probably benign Het
Myo18a T A 11: 77,714,156 (GRCm39) L389Q probably damaging Het
Myom2 A G 8: 15,160,827 (GRCm39) D900G probably benign Het
Nfasc T C 1: 132,534,795 (GRCm39) probably benign Het
Obscn A T 11: 58,912,309 (GRCm39) S7044R probably damaging Het
Or5bw2 T A 7: 6,573,111 (GRCm39) N40K probably damaging Het
Or5e1 T C 7: 108,354,090 (GRCm39) V9A possibly damaging Het
Or6k4 T C 1: 173,964,457 (GRCm39) V49A probably benign Het
Pde4c T A 8: 71,201,066 (GRCm39) H421Q probably damaging Het
Pnmt G T 11: 98,278,502 (GRCm39) R156L probably benign Het
Pramel22 A C 4: 143,381,942 (GRCm39) C251W probably damaging Het
Rnf138 A G 18: 21,159,159 (GRCm39) E193G probably damaging Het
Sesn1 G T 10: 41,778,589 (GRCm39) R346L possibly damaging Het
Setd4 G T 16: 93,382,082 (GRCm39) H390Q probably benign Het
Supt6 T C 11: 78,116,299 (GRCm39) E688G possibly damaging Het
Syne2 G A 12: 76,156,609 (GRCm39) D6802N probably benign Het
Syt16 A G 12: 74,313,672 (GRCm39) K533E probably damaging Het
Tg A T 15: 66,591,504 (GRCm39) Q26H probably benign Het
Trim33 G T 3: 103,218,201 (GRCm39) W250L probably damaging Het
Trip4 A G 9: 65,788,188 (GRCm39) C86R probably benign Het
Upf2 T A 2: 6,030,986 (GRCm39) C809S unknown Het
Vrk2 A G 11: 26,499,325 (GRCm39) F76L probably damaging Het
Zfp804a A G 2: 82,087,844 (GRCm39) T558A probably damaging Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47,485,978 (GRCm39) missense probably benign
IGL02410:Cul1 APN 6 47,461,948 (GRCm39) missense probably damaging 1.00
IGL02458:Cul1 APN 6 47,502,542 (GRCm39) missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47,491,820 (GRCm39) missense probably damaging 0.98
IGL03065:Cul1 APN 6 47,472,015 (GRCm39) missense probably damaging 1.00
IGL03387:Cul1 APN 6 47,478,143 (GRCm39) missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47,500,139 (GRCm39) missense probably benign 0.01
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0064:Cul1 UTSW 6 47,479,349 (GRCm39) splice site probably benign
R0436:Cul1 UTSW 6 47,500,707 (GRCm39) missense probably benign 0.16
R0746:Cul1 UTSW 6 47,495,222 (GRCm39) splice site probably null
R1471:Cul1 UTSW 6 47,491,820 (GRCm39) missense probably damaging 0.98
R1746:Cul1 UTSW 6 47,485,179 (GRCm39) missense probably damaging 0.98
R1852:Cul1 UTSW 6 47,497,764 (GRCm39) missense probably damaging 0.99
R1858:Cul1 UTSW 6 47,502,458 (GRCm39) splice site probably null
R1937:Cul1 UTSW 6 47,485,289 (GRCm39) missense probably benign 0.19
R1964:Cul1 UTSW 6 47,479,505 (GRCm39) missense probably damaging 0.98
R2985:Cul1 UTSW 6 47,479,441 (GRCm39) missense probably damaging 1.00
R4452:Cul1 UTSW 6 47,485,923 (GRCm39) nonsense probably null
R4653:Cul1 UTSW 6 47,461,897 (GRCm39) missense probably damaging 1.00
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,080 (GRCm39) missense probably benign 0.38
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R4860:Cul1 UTSW 6 47,494,125 (GRCm39) missense probably damaging 0.99
R5141:Cul1 UTSW 6 47,497,773 (GRCm39) missense probably benign 0.04
R5328:Cul1 UTSW 6 47,485,251 (GRCm39) missense probably damaging 0.99
R5399:Cul1 UTSW 6 47,462,018 (GRCm39) splice site probably null
R5593:Cul1 UTSW 6 47,491,925 (GRCm39) missense probably damaging 0.99
R5593:Cul1 UTSW 6 47,462,020 (GRCm39) nonsense probably null
R5616:Cul1 UTSW 6 47,500,722 (GRCm39) missense probably damaging 1.00
R5855:Cul1 UTSW 6 47,500,147 (GRCm39) missense probably benign 0.00
R6382:Cul1 UTSW 6 47,479,373 (GRCm39) missense probably damaging 1.00
R6670:Cul1 UTSW 6 47,494,068 (GRCm39) missense probably damaging 1.00
R6964:Cul1 UTSW 6 47,493,443 (GRCm39) missense probably benign 0.01
R8146:Cul1 UTSW 6 47,472,027 (GRCm39) missense possibly damaging 0.50
R8373:Cul1 UTSW 6 47,491,997 (GRCm39) missense possibly damaging 0.78
R8842:Cul1 UTSW 6 47,492,010 (GRCm39) missense probably damaging 1.00
R8899:Cul1 UTSW 6 47,474,246 (GRCm39) missense possibly damaging 0.84
R9093:Cul1 UTSW 6 47,495,173 (GRCm39) missense probably damaging 1.00
R9352:Cul1 UTSW 6 47,479,426 (GRCm39) missense probably benign 0.00
RF001:Cul1 UTSW 6 47,501,515 (GRCm39) missense possibly damaging 0.50
RF055:Cul1 UTSW 6 47,494,067 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCAAGCAGCTCCTGGAGGTAG -3'
(R):5'- AGCCAACAAGGCTGGATGTGTG -3'

Sequencing Primer
(F):5'- CTCCTGGAGGTAGCTAGAGAC -3'
(R):5'- GAACCCTAAACAGGGTGGC -3'
Posted On 2014-01-05