Incidental Mutation 'R1103:Map1b'
ID 98301
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 039176-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1103 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 99563974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect probably benign
Transcript: ENSMUST00000064762
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
4930524J08Rik G A 5: 100,126,980 (GRCm39) probably benign Het
Adam3 T A 8: 25,204,287 (GRCm39) probably benign Het
Adpgk A G 9: 59,221,079 (GRCm39) H295R probably damaging Het
Aftph A T 11: 20,676,547 (GRCm39) M199K probably benign Het
Ap2a1 C A 7: 44,553,593 (GRCm39) probably benign Het
Atpaf2 T C 11: 60,294,776 (GRCm39) I216V probably benign Het
Bag4 A T 8: 26,257,891 (GRCm39) probably benign Het
Bltp1 A T 3: 37,050,672 (GRCm39) M3003L probably benign Het
Bud23 T C 5: 135,089,993 (GRCm39) S67G probably damaging Het
Cfap157 A G 2: 32,671,410 (GRCm39) F132S probably damaging Het
Cngb3 G A 4: 19,309,658 (GRCm39) probably null Het
Cntnap5a A G 1: 116,508,399 (GRCm39) I1304V possibly damaging Het
Cp A G 3: 20,036,149 (GRCm39) K764E possibly damaging Het
Crebbp A G 16: 3,901,925 (GRCm39) V2438A probably damaging Het
Csmd3 A T 15: 47,811,402 (GRCm39) W1230R probably damaging Het
Cul1 G A 6: 47,494,111 (GRCm39) V475I probably benign Het
Dnttip2 T C 3: 122,070,071 (GRCm39) S429P probably benign Het
Dtwd1 T C 2: 125,996,643 (GRCm39) S43P probably damaging Het
Ect2l T C 10: 18,016,274 (GRCm39) T705A probably damaging Het
Erbin G T 13: 104,022,710 (GRCm39) T43N probably benign Het
Fcgbpl1 G T 7: 27,853,945 (GRCm39) L1636F probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Gpr150 G T 13: 76,203,712 (GRCm39) P411Q probably damaging Het
Grap C A 11: 61,562,544 (GRCm39) Q172K probably benign Het
Ido2 G A 8: 25,066,239 (GRCm39) T9M probably benign Het
Klkb1 C A 8: 45,729,183 (GRCm39) C347F probably damaging Het
Klra17 G A 6: 129,845,806 (GRCm39) probably benign Het
Lama1 T C 17: 68,097,942 (GRCm39) L1774P probably damaging Het
Lhpp A T 7: 132,212,484 (GRCm39) D17V probably damaging Het
Lrfn4 T C 19: 4,663,299 (GRCm39) T412A probably benign Het
Lrrc7 C T 3: 157,854,343 (GRCm39) probably benign Het
Ltbp3 A T 19: 5,797,439 (GRCm39) probably null Het
Ltbp3 G C 19: 5,797,440 (GRCm39) probably null Het
Luzp1 T A 4: 136,268,041 (GRCm39) L88Q possibly damaging Het
Magi2 T C 5: 20,816,101 (GRCm39) I747T probably damaging Het
Map3k4 A T 17: 12,455,950 (GRCm39) probably null Het
Map3k5 C A 10: 19,899,422 (GRCm39) D226E probably benign Het
Mtf1 T A 4: 124,732,261 (GRCm39) S440T probably benign Het
Myo18a T A 11: 77,714,156 (GRCm39) L389Q probably damaging Het
Myom2 A G 8: 15,160,827 (GRCm39) D900G probably benign Het
Nfasc T C 1: 132,534,795 (GRCm39) probably benign Het
Obscn A T 11: 58,912,309 (GRCm39) S7044R probably damaging Het
Or5bw2 T A 7: 6,573,111 (GRCm39) N40K probably damaging Het
Or5e1 T C 7: 108,354,090 (GRCm39) V9A possibly damaging Het
Or6k4 T C 1: 173,964,457 (GRCm39) V49A probably benign Het
Pde4c T A 8: 71,201,066 (GRCm39) H421Q probably damaging Het
Pnmt G T 11: 98,278,502 (GRCm39) R156L probably benign Het
Pramel22 A C 4: 143,381,942 (GRCm39) C251W probably damaging Het
Rnf138 A G 18: 21,159,159 (GRCm39) E193G probably damaging Het
Sesn1 G T 10: 41,778,589 (GRCm39) R346L possibly damaging Het
Setd4 G T 16: 93,382,082 (GRCm39) H390Q probably benign Het
Supt6 T C 11: 78,116,299 (GRCm39) E688G possibly damaging Het
Syne2 G A 12: 76,156,609 (GRCm39) D6802N probably benign Het
Syt16 A G 12: 74,313,672 (GRCm39) K533E probably damaging Het
Tg A T 15: 66,591,504 (GRCm39) Q26H probably benign Het
Trim33 G T 3: 103,218,201 (GRCm39) W250L probably damaging Het
Trip4 A G 9: 65,788,188 (GRCm39) C86R probably benign Het
Upf2 T A 2: 6,030,986 (GRCm39) C809S unknown Het
Vrk2 A G 11: 26,499,325 (GRCm39) F76L probably damaging Het
Zfp804a A G 2: 82,087,844 (GRCm39) T558A probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCACAGGGACAAAGACGCCTATTTC -3'
(R):5'- TGTCTGCAAAGGGAAGCCAAGTC -3'

Sequencing Primer
(F):5'- GTTCAAATGCACCTCAGACATGG -3'
(R):5'- AGGGAAGCCAAGTCTTTTTCAG -3'
Posted On 2014-01-05