Mutagenetix > Incidental Mutation

Incidental Mutation 'R1103:Map1b'

98301

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

039176-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1103 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 99427466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

probably benign
Transcript: ENSMUST00000064762

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.7%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
4930524J08Rik	G	A	5: 99,979,121		probably benign	Het
4932438A13Rik	A	T	3: 36,996,523	M3003L	probably benign	Het
9530053A07Rik	G	T	7: 28,154,520	L1636F	probably damaging	Het
Adam3	T	A	8: 24,714,271		probably benign	Het
Adpgk	A	G	9: 59,313,796	H295R	probably damaging	Het
Aftph	A	T	11: 20,726,547	M199K	probably benign	Het
Ap2a1	C	A	7: 44,904,169		probably benign	Het
Atpaf2	T	C	11: 60,403,950	I216V	probably benign	Het
Bag4	A	T	8: 25,767,863		probably benign	Het
Bud23	T	C	5: 135,061,139	S67G	probably damaging	Het
Cfap157	A	G	2: 32,781,398	F132S	probably damaging	Het
Cngb3	G	A	4: 19,309,658		probably null	Het
Cntnap5a	A	G	1: 116,580,669	I1304V	possibly damaging	Het
Cp	A	G	3: 19,981,985	K764E	possibly damaging	Het
Crebbp	A	G	16: 4,084,061	V2438A	probably damaging	Het
Csmd3	A	T	15: 47,948,006	W1230R	probably damaging	Het
Cul1	G	A	6: 47,517,177	V475I	probably benign	Het
Dnttip2	T	C	3: 122,276,422	S429P	probably benign	Het
Dtwd1	T	C	2: 126,154,723	S43P	probably damaging	Het
Ect2l	T	C	10: 18,140,526	T705A	probably damaging	Het
Erbin	G	T	13: 103,886,202	T43N	probably benign	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Gm13088	A	C	4: 143,655,372	C251W	probably damaging	Het
Gpr150	G	T	13: 76,055,593	P411Q	probably damaging	Het
Grap	C	A	11: 61,671,718	Q172K	probably benign	Het
Ido2	G	A	8: 24,576,223	T9M	probably benign	Het
Klkb1	C	A	8: 45,276,146	C347F	probably damaging	Het
Klra17	G	A	6: 129,868,843		probably benign	Het
Lama1	T	C	17: 67,790,947	L1774P	probably damaging	Het
Lhpp	A	T	7: 132,610,755	D17V	probably damaging	Het
Lrfn4	T	C	19: 4,613,271	T412A	probably benign	Het
Lrrc7	C	T	3: 158,148,706		probably benign	Het
Ltbp3	G	C	19: 5,747,412		probably null	Het
Ltbp3	A	T	19: 5,747,411		probably null	Het
Luzp1	T	A	4: 136,540,730	L88Q	possibly damaging	Het
Magi2	T	C	5: 20,611,103	I747T	probably damaging	Het
Map3k4	A	T	17: 12,237,063		probably null	Het
Map3k5	C	A	10: 20,023,676	D226E	probably benign	Het
Mtf1	T	A	4: 124,838,468	S440T	probably benign	Het
Myo18a	T	A	11: 77,823,330	L389Q	probably damaging	Het
Myom2	A	G	8: 15,110,827	D900G	probably benign	Het
Nfasc	T	C	1: 132,607,057		probably benign	Het
Obscn	A	T	11: 59,021,483	S7044R	probably damaging	Het
Olfr1350	T	A	7: 6,570,112	N40K	probably damaging	Het
Olfr424	T	C	1: 174,136,891	V49A	probably benign	Het
Olfr513	T	C	7: 108,754,883	V9A	possibly damaging	Het
Pde4c	T	A	8: 70,748,417	H421Q	probably damaging	Het
Pnmt	G	T	11: 98,387,676	R156L	probably benign	Het
Rnf138	A	G	18: 21,026,102	E193G	probably damaging	Het
Sesn1	G	T	10: 41,902,593	R346L	possibly damaging	Het
Setd4	G	T	16: 93,585,194	H390Q	probably benign	Het
Supt6	T	C	11: 78,225,473	E688G	possibly damaging	Het
Syne2	G	A	12: 76,109,835	D6802N	probably benign	Het
Syt16	A	G	12: 74,266,898	K533E	probably damaging	Het
Tg	A	T	15: 66,719,655	Q26H	probably benign	Het
Trim33	G	T	3: 103,310,885	W250L	probably damaging	Het
Trip4	A	G	9: 65,880,906	C86R	probably benign	Het
Upf2	T	A	2: 6,026,175	C809S	unknown	Het
Vrk2	A	G	11: 26,549,325	F76L	probably damaging	Het
Zfp804a	A	G	2: 82,257,500	T558A	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- CCACAGGGACAAAGACGCCTATTTC -3'
(R):5'- TGTCTGCAAAGGGAAGCCAAGTC -3'

Sequencing Primer
(F):5'- GTTCAAATGCACCTCAGACATGG -3'
(R):5'- AGGGAAGCCAAGTCTTTTTCAG -3'

Posted On

2014-01-05