Incidental Mutation 'R1103:Rnf138'
Institutional Source Beutler Lab
Gene Symbol Rnf138
Ensembl Gene ENSMUSG00000024317
Gene Namering finger protein 138
Synonyms2810480D20Rik, 2410015A17Rik, Trif-d
MMRRC Submission 039176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1103 (G1)
Quality Score225
Status Validated
Chromosomal Location21001341-21028223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21026102 bp
Amino Acid Change Glutamic Acid to Glycine at position 193 (E193G)
Ref Sequence ENSEMBL: ENSMUSP00000072626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052396] [ENSMUST00000072847]
Predicted Effect probably damaging
Transcript: ENSMUST00000052396
AA Change: E229G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056641
Gene: ENSMUSG00000024317
AA Change: E229G

RING 18 57 1.65e-5 SMART
ZnF_C2H2 157 180 1.62e0 SMART
RING 159 192 1.5e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000072847
AA Change: E193G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072626
Gene: ENSMUSG00000024317
AA Change: E193G

RING 18 57 1.65e-5 SMART
ZnF_C2H2 157 180 1.62e0 SMART
Meta Mutation Damage Score 0.1777 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930524J08Rik G A 5: 99,979,121 probably benign Het
4932438A13Rik A T 3: 36,996,523 M3003L probably benign Het
9530053A07Rik G T 7: 28,154,520 L1636F probably damaging Het
Adam3 T A 8: 24,714,271 probably benign Het
Adpgk A G 9: 59,313,796 H295R probably damaging Het
Aftph A T 11: 20,726,547 M199K probably benign Het
Ap2a1 C A 7: 44,904,169 probably benign Het
Atpaf2 T C 11: 60,403,950 I216V probably benign Het
Bag4 A T 8: 25,767,863 probably benign Het
Bud23 T C 5: 135,061,139 S67G probably damaging Het
Cfap157 A G 2: 32,781,398 F132S probably damaging Het
Cngb3 G A 4: 19,309,658 probably null Het
Cntnap5a A G 1: 116,580,669 I1304V possibly damaging Het
Cp A G 3: 19,981,985 K764E possibly damaging Het
Crebbp A G 16: 4,084,061 V2438A probably damaging Het
Csmd3 A T 15: 47,948,006 W1230R probably damaging Het
Cul1 G A 6: 47,517,177 V475I probably benign Het
Dnttip2 T C 3: 122,276,422 S429P probably benign Het
Dtwd1 T C 2: 126,154,723 S43P probably damaging Het
Ect2l T C 10: 18,140,526 T705A probably damaging Het
Erbin G T 13: 103,886,202 T43N probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm13088 A C 4: 143,655,372 C251W probably damaging Het
Gpr150 G T 13: 76,055,593 P411Q probably damaging Het
Grap C A 11: 61,671,718 Q172K probably benign Het
Ido2 G A 8: 24,576,223 T9M probably benign Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Klra17 G A 6: 129,868,843 probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lhpp A T 7: 132,610,755 D17V probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Lrrc7 C T 3: 158,148,706 probably benign Het
Ltbp3 A T 19: 5,747,411 probably null Het
Ltbp3 G C 19: 5,747,412 probably null Het
Luzp1 T A 4: 136,540,730 L88Q possibly damaging Het
Magi2 T C 5: 20,611,103 I747T probably damaging Het
Map1b A T 13: 99,427,466 probably benign Het
Map3k4 A T 17: 12,237,063 probably null Het
Map3k5 C A 10: 20,023,676 D226E probably benign Het
Mtf1 T A 4: 124,838,468 S440T probably benign Het
Myo18a T A 11: 77,823,330 L389Q probably damaging Het
Myom2 A G 8: 15,110,827 D900G probably benign Het
Nfasc T C 1: 132,607,057 probably benign Het
Obscn A T 11: 59,021,483 S7044R probably damaging Het
Olfr1350 T A 7: 6,570,112 N40K probably damaging Het
Olfr424 T C 1: 174,136,891 V49A probably benign Het
Olfr513 T C 7: 108,754,883 V9A possibly damaging Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Sesn1 G T 10: 41,902,593 R346L possibly damaging Het
Setd4 G T 16: 93,585,194 H390Q probably benign Het
Supt6 T C 11: 78,225,473 E688G possibly damaging Het
Syne2 G A 12: 76,109,835 D6802N probably benign Het
Syt16 A G 12: 74,266,898 K533E probably damaging Het
Tg A T 15: 66,719,655 Q26H probably benign Het
Trim33 G T 3: 103,310,885 W250L probably damaging Het
Trip4 A G 9: 65,880,906 C86R probably benign Het
Upf2 T A 2: 6,026,175 C809S unknown Het
Vrk2 A G 11: 26,549,325 F76L probably damaging Het
Zfp804a A G 2: 82,257,500 T558A probably damaging Het
Other mutations in Rnf138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Rnf138 APN 18 21020960 missense possibly damaging 0.91
IGL01099:Rnf138 APN 18 21020913 missense possibly damaging 0.50
IGL01471:Rnf138 APN 18 21024521 splice site probably null
R0655:Rnf138 UTSW 18 21010783 missense probably benign 0.00
R1420:Rnf138 UTSW 18 21026102 missense probably damaging 1.00
R1993:Rnf138 UTSW 18 21024483 missense probably damaging 1.00
R2171:Rnf138 UTSW 18 21026086 missense probably damaging 1.00
R4682:Rnf138 UTSW 18 21010734 missense probably damaging 1.00
R5074:Rnf138 UTSW 18 21026147 missense probably benign 0.36
R6866:Rnf138 UTSW 18 21002142 missense probably damaging 1.00
R7257:Rnf138 UTSW 18 21008693 intron probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccattatgtccatgctggtttc -3'
Posted On2014-01-05