Incidental Mutation 'R1104:Itih5'
ID 98325
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R1104 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10251512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 930 (T930A)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: T930A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: T930A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mark3 C T 12: 111,618,397 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
R9744:Itih5 UTSW 2 10251410 missense probably damaging 1.00
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTCCTGAGGAATACGGCAAGAATC -3'
(R):5'- AGAGACATTGGACCTCCAGCTCAC -3'

Sequencing Primer
(F):5'- AGTAACCAGCCATTTCCTCGG -3'
(R):5'- ACCTCCAGCTCACCAGGG -3'
Posted On 2014-01-05