Mutagenetix > Incidental Mutation

Incidental Mutation 'R1104:Ago1'

98342

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

039177-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R1104 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126453633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 441 (Y441C)

Ref Sequence

ENSEMBL: ENSMUSP00000095498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000097888
AA Change: Y441C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: Y441C

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176315
AA Change: Y137C

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: Y137C

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Meta Mutation Damage Score

0.5971

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
4430402I18Rik	T	C	19: 28,967,632	M1V	probably null	Het
4930550C14Rik	A	G	9: 53,421,617	I93V	probably benign	Het
Abcg5	A	C	17: 84,682,049	I77S	possibly damaging	Het
Adam3	T	C	8: 24,681,529	Y762C	probably benign	Het
Agap1	T	C	1: 89,789,240	S26P	probably damaging	Het
B3gnt3	A	G	8: 71,693,837	L16S	possibly damaging	Het
Btaf1	T	A	19: 37,004,602	D1677E	probably damaging	Het
Cd5l	T	A	3: 87,360,899	S18T	probably benign	Het
Cdca2	T	A	14: 67,693,682	R521W	probably damaging	Het
Cfap61	C	A	2: 145,951,061	S64*	probably null	Het
Cryzl2	T	A	1: 157,470,604		probably benign	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dhrs1	T	C	14: 55,743,705	K83E	probably benign	Het
Dmrt2	T	A	19: 25,678,616	F526L	probably benign	Het
Dnajb14	T	A	3: 137,908,354	M342K	possibly damaging	Het
Dpf3	A	G	12: 83,331,987	V101A	probably benign	Het
Dthd1	A	C	5: 62,821,959	T321P	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Fras1	G	A	5: 96,708,671	R1971Q	probably benign	Het
Fry	A	G	5: 150,496,289	N608S	probably damaging	Het
Gabrr3	T	A	16: 59,461,635	V451D	probably damaging	Het
Glg1	A	G	8: 111,197,603	L251P	probably benign	Het
Gli2	T	A	1: 118,853,350	S222C	probably damaging	Het
Gm340	G	T	19: 41,586,063	G1086C	probably damaging	Het
Gsr	A	G	8: 33,669,921	E99G	probably damaging	Het
Hist1h1b	T	C	13: 21,780,281	T92A	possibly damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Hus1b	T	C	13: 30,947,696		probably benign	Het
Igf1r	T	A	7: 68,195,026	I849N	possibly damaging	Het
Itih5	A	G	2: 10,251,512	T930A	probably benign	Het
Ivns1abp	T	A	1: 151,360,109	M309K	probably benign	Het
Kdm3b	T	A	18: 34,819,811	F1078Y	probably damaging	Het
Krt12	C	A	11: 99,421,966	G84V	unknown	Het
Krt40	T	G	11: 99,540,233	E150A	probably damaging	Het
Lcn11	G	T	2: 25,779,103		probably benign	Het
Liph	A	G	16: 21,984,148	I57T	possibly damaging	Het
Lrrc46	C	T	11: 97,036,171	V107M	probably damaging	Het
Ltb4r1	T	C	14: 55,767,375	I45T	probably damaging	Het
Mapkbp1	A	G	2: 120,011,073		probably benign	Het
Mark3	C	T	12: 111,618,397		probably benign	Het
Mug2	C	T	6: 122,059,055	A642V	probably benign	Het
Myh11	A	G	16: 14,202,127	S1814P	possibly damaging	Het
Ndst1	T	A	18: 60,697,146	S631C	probably damaging	Het
Nrbf2	A	T	10: 67,267,912	D137E	possibly damaging	Het
Olfr630	A	G	7: 103,754,976	V203A	probably benign	Het
Olfr698	A	T	7: 106,752,782	M202K	probably benign	Het
Olfr784	T	A	10: 129,388,221	M196K	probably benign	Het
Parn	A	G	16: 13,667,585	Y16H	probably damaging	Het
Parp14	A	G	16: 35,844,415		probably benign	Het
Prl3d1	C	T	13: 27,100,009	T187I	probably benign	Het
Ptgir	G	A	7: 16,907,130		probably null	Het
Rabgap1l	C	T	1: 160,231,875		probably benign	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rnf213	T	C	11: 119,477,229	Y4697H	probably benign	Het
Rps6ka4	T	A	19: 6,830,996	I598F	probably damaging	Het
Ryr2	C	T	13: 11,669,969	V3029M	probably damaging	Het
Slc17a2	T	C	13: 23,819,937	F335S	probably damaging	Het
Stau2	A	T	1: 16,440,361	Y124*	probably null	Het
Tbl3	A	G	17: 24,701,606	I652T	probably benign	Het
Trappc3	C	T	4: 126,272,966		probably benign	Het
Trim60	A	T	8: 65,001,419	F59L	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	T	C	1: 188,916,256	F4686S	probably benign	Het
Vcan	T	C	13: 89,692,410	T1672A	probably damaging	Het
Vmn1r215	T	A	13: 23,076,588	I266N	possibly damaging	Het
Vmn2r6	A	T	3: 64,538,066	V657E	possibly damaging	Het
Wdr95	G	T	5: 149,606,337	A548S	probably benign	Het
Zfp12	A	G	5: 143,245,745	Y609C	probably damaging	Het
Znfx1	C	A	2: 167,055,640	E455*	probably null	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTCCTGAACTCATCTGACCAC -3'
(R):5'- AGTATTGCCAAGCTGCTGGTCTC -3'

Sequencing Primer
(F):5'- CAGATCGCCGGTCAGTTC -3'
(R):5'- TCCCTACATCCAGGAATTTGGAATC -3'

Posted On

2014-01-05