Incidental Mutation 'R1104:Mug2'
ID98357
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1104 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122059055 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 642 (A642V)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: A642V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: A642V

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mark3 C T 12: 111,618,397 probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAACCACAATGTTAGCCAAGG -3'
(R):5'- CGACTTGTTGGGGAACACAGTGAAG -3'

Sequencing Primer
(F):5'- AGGCTAACTAGGAAATTGCCC -3'
(R):5'- gagaggcacaggcagac -3'
Posted On2014-01-05