Incidental Mutation 'R1104:Igf1r'
ID 98363
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms IGF-1R, line 186, A330103N21Rik, hyft, CD221
MMRRC Submission 039177-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1104 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 67602575-67883416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67844774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 849 (I849N)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000005671
AA Change: I849N

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: I849N

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Meta Mutation Damage Score 0.9251 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
4930550C14Rik A G 9: 53,332,917 (GRCm39) I93V probably benign Het
Abcg5 A C 17: 84,989,477 (GRCm39) I77S possibly damaging Het
Adam3 T C 8: 25,171,545 (GRCm39) Y762C probably benign Het
Agap1 T C 1: 89,716,962 (GRCm39) S26P probably damaging Het
Ago1 T C 4: 126,347,426 (GRCm39) Y441C probably damaging Het
B3gnt3 A G 8: 72,146,481 (GRCm39) L16S possibly damaging Het
Btaf1 T A 19: 36,982,002 (GRCm39) D1677E probably damaging Het
Cd5l T A 3: 87,268,206 (GRCm39) S18T probably benign Het
Cdca2 T A 14: 67,931,131 (GRCm39) R521W probably damaging Het
Cfap61 C A 2: 145,792,981 (GRCm39) S64* probably null Het
Cryzl2 T A 1: 157,298,174 (GRCm39) probably benign Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dhrs1 T C 14: 55,981,162 (GRCm39) K83E probably benign Het
Dmrt2 T A 19: 25,655,980 (GRCm39) F526L probably benign Het
Dnajb14 T A 3: 137,614,115 (GRCm39) M342K possibly damaging Het
Dpf3 A G 12: 83,378,761 (GRCm39) V101A probably benign Het
Dthd1 A C 5: 62,979,302 (GRCm39) T321P probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Fras1 G A 5: 96,856,530 (GRCm39) R1971Q probably benign Het
Fry A G 5: 150,419,754 (GRCm39) N608S probably damaging Het
Gabrr3 T A 16: 59,281,998 (GRCm39) V451D probably damaging Het
Glg1 A G 8: 111,924,235 (GRCm39) L251P probably benign Het
Gli2 T A 1: 118,781,080 (GRCm39) S222C probably damaging Het
Gsr A G 8: 34,159,949 (GRCm39) E99G probably damaging Het
H1f5 T C 13: 21,964,451 (GRCm39) T92A possibly damaging Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Hus1b T C 13: 31,131,679 (GRCm39) probably benign Het
Itih5 A G 2: 10,256,323 (GRCm39) T930A probably benign Het
Ivns1abp T A 1: 151,235,860 (GRCm39) M309K probably benign Het
Kdm3b T A 18: 34,952,864 (GRCm39) F1078Y probably damaging Het
Krt12 C A 11: 99,312,792 (GRCm39) G84V unknown Het
Krt40 T G 11: 99,431,059 (GRCm39) E150A probably damaging Het
Lcn11 G T 2: 25,669,115 (GRCm39) probably benign Het
Lcor G T 19: 41,574,502 (GRCm39) G1086C probably damaging Het
Liph A G 16: 21,802,898 (GRCm39) I57T possibly damaging Het
Lrrc46 C T 11: 96,926,997 (GRCm39) V107M probably damaging Het
Ltb4r1 T C 14: 56,004,832 (GRCm39) I45T probably damaging Het
Mapkbp1 A G 2: 119,841,554 (GRCm39) probably benign Het
Mark3 C T 12: 111,584,831 (GRCm39) probably benign Het
Mug2 C T 6: 122,036,014 (GRCm39) A642V probably benign Het
Myh11 A G 16: 14,019,991 (GRCm39) S1814P possibly damaging Het
Ndst1 T A 18: 60,830,218 (GRCm39) S631C probably damaging Het
Nrbf2 A T 10: 67,103,691 (GRCm39) D137E possibly damaging Het
Or2ag16 A T 7: 106,351,989 (GRCm39) M202K probably benign Het
Or51l4 A G 7: 103,404,183 (GRCm39) V203A probably benign Het
Or6c208 T A 10: 129,224,090 (GRCm39) M196K probably benign Het
Parn A G 16: 13,485,449 (GRCm39) Y16H probably damaging Het
Parp14 A G 16: 35,664,785 (GRCm39) probably benign Het
Prl3d1 C T 13: 27,283,992 (GRCm39) T187I probably benign Het
Ptgir G A 7: 16,641,055 (GRCm39) probably null Het
Rabgap1l C T 1: 160,059,445 (GRCm39) probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Rnf213 T C 11: 119,368,055 (GRCm39) Y4697H probably benign Het
Rps6ka4 T A 19: 6,808,364 (GRCm39) I598F probably damaging Het
Ryr2 C T 13: 11,684,855 (GRCm39) V3029M probably damaging Het
Slc34a1 T C 13: 24,003,920 (GRCm39) F335S probably damaging Het
Spata6l T C 19: 28,945,032 (GRCm39) M1V probably null Het
Stau2 A T 1: 16,510,585 (GRCm39) Y124* probably null Het
Tbl3 A G 17: 24,920,580 (GRCm39) I652T probably benign Het
Trappc3 C T 4: 126,166,759 (GRCm39) probably benign Het
Trim60 A T 8: 65,454,071 (GRCm39) F59L probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a T C 1: 188,648,453 (GRCm39) F4686S probably benign Het
Vcan T C 13: 89,840,529 (GRCm39) T1672A probably damaging Het
Vmn1r215 T A 13: 23,260,758 (GRCm39) I266N possibly damaging Het
Vmn2r6 A T 3: 64,445,487 (GRCm39) V657E possibly damaging Het
Wdr95 G T 5: 149,529,802 (GRCm39) A548S probably benign Het
Zfp12 A G 5: 143,231,500 (GRCm39) Y609C probably damaging Het
Znfx1 C A 2: 166,897,560 (GRCm39) E455* probably null Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 67,839,771 (GRCm39) missense probably benign
IGL00837:Igf1r APN 7 67,851,100 (GRCm39) splice site probably benign
IGL01515:Igf1r APN 7 67,857,200 (GRCm39) missense probably damaging 1.00
IGL01572:Igf1r APN 7 67,843,189 (GRCm39) missense probably benign 0.01
IGL02100:Igf1r APN 7 67,839,706 (GRCm39) missense probably benign 0.05
IGL02506:Igf1r APN 7 67,843,144 (GRCm39) missense probably benign
IGL02672:Igf1r APN 7 67,839,781 (GRCm39) missense probably benign 0.05
IGL02701:Igf1r APN 7 67,850,997 (GRCm39) missense possibly damaging 0.93
IGL02742:Igf1r APN 7 67,839,739 (GRCm39) missense possibly damaging 0.94
IGL03073:Igf1r APN 7 67,864,791 (GRCm39) missense probably damaging 1.00
IGL03257:Igf1r APN 7 67,864,688 (GRCm39) missense probably damaging 1.00
Frufru UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
Hungarian UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
Mimi UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
Piroshka UTSW 7 67,857,084 (GRCm39) nonsense probably null
Romanian UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
Sublime UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
Toy UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
BB009:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
BB019:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4737:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
PIT4445001:Igf1r UTSW 7 67,857,211 (GRCm39) missense probably damaging 1.00
R0003:Igf1r UTSW 7 67,814,990 (GRCm39) missense probably damaging 1.00
R0184:Igf1r UTSW 7 67,875,941 (GRCm39) missense possibly damaging 0.84
R0538:Igf1r UTSW 7 67,857,574 (GRCm39) missense probably damaging 1.00
R0632:Igf1r UTSW 7 67,814,903 (GRCm39) missense probably damaging 1.00
R0727:Igf1r UTSW 7 67,861,906 (GRCm39) critical splice donor site probably null
R0750:Igf1r UTSW 7 67,861,839 (GRCm39) missense probably damaging 0.99
R1169:Igf1r UTSW 7 67,814,875 (GRCm39) missense probably benign 0.00
R1348:Igf1r UTSW 7 67,868,216 (GRCm39) missense probably damaging 1.00
R1471:Igf1r UTSW 7 67,653,585 (GRCm39) missense probably damaging 0.98
R1580:Igf1r UTSW 7 67,857,617 (GRCm39) missense probably benign
R1745:Igf1r UTSW 7 67,819,661 (GRCm39) missense probably damaging 1.00
R1772:Igf1r UTSW 7 67,844,822 (GRCm39) missense probably benign 0.03
R1789:Igf1r UTSW 7 67,864,681 (GRCm39) nonsense probably null
R1823:Igf1r UTSW 7 67,844,729 (GRCm39) missense possibly damaging 0.77
R1902:Igf1r UTSW 7 67,850,997 (GRCm39) missense possibly damaging 0.93
R1962:Igf1r UTSW 7 67,857,023 (GRCm39) missense probably damaging 0.99
R2179:Igf1r UTSW 7 67,653,698 (GRCm39) missense probably damaging 0.99
R2215:Igf1r UTSW 7 67,814,982 (GRCm39) missense probably benign
R2221:Igf1r UTSW 7 67,851,710 (GRCm39) missense probably damaging 1.00
R2233:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2234:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2235:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R3023:Igf1r UTSW 7 67,833,147 (GRCm39) missense probably benign 0.00
R4044:Igf1r UTSW 7 67,839,810 (GRCm39) missense possibly damaging 0.83
R4226:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R4387:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4388:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4728:Igf1r UTSW 7 67,839,372 (GRCm39) missense probably damaging 1.00
R4781:Igf1r UTSW 7 67,814,947 (GRCm39) missense possibly damaging 0.75
R5254:Igf1r UTSW 7 67,857,067 (GRCm39) missense probably damaging 0.99
R5278:Igf1r UTSW 7 67,843,166 (GRCm39) missense possibly damaging 0.78
R5510:Igf1r UTSW 7 67,843,107 (GRCm39) missense probably benign 0.19
R5522:Igf1r UTSW 7 67,833,258 (GRCm39) missense probably damaging 0.96
R5527:Igf1r UTSW 7 67,857,569 (GRCm39) missense probably damaging 1.00
R5761:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R5849:Igf1r UTSW 7 67,839,781 (GRCm39) missense probably benign
R6189:Igf1r UTSW 7 67,857,084 (GRCm39) nonsense probably null
R6262:Igf1r UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
R6285:Igf1r UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
R6318:Igf1r UTSW 7 67,814,981 (GRCm39) missense probably benign 0.02
R6365:Igf1r UTSW 7 67,839,798 (GRCm39) missense probably benign 0.26
R6377:Igf1r UTSW 7 67,850,998 (GRCm39) missense probably benign 0.00
R6831:Igf1r UTSW 7 67,857,067 (GRCm39) missense possibly damaging 0.75
R6848:Igf1r UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
R6902:Igf1r UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
R7193:Igf1r UTSW 7 67,836,905 (GRCm39) missense probably damaging 1.00
R7373:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R7442:Igf1r UTSW 7 67,823,026 (GRCm39) missense probably damaging 1.00
R7903:Igf1r UTSW 7 67,834,500 (GRCm39) missense probably damaging 1.00
R7923:Igf1r UTSW 7 67,839,849 (GRCm39) missense probably damaging 1.00
R7932:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
R8368:Igf1r UTSW 7 67,836,796 (GRCm39) missense probably benign 0.03
R8458:Igf1r UTSW 7 67,845,377 (GRCm39) missense probably benign
R8539:Igf1r UTSW 7 67,653,596 (GRCm39) missense probably benign 0.06
R8704:Igf1r UTSW 7 67,819,802 (GRCm39) splice site probably benign
R8746:Igf1r UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
R8829:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8832:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8859:Igf1r UTSW 7 67,833,211 (GRCm39) missense possibly damaging 0.75
R9057:Igf1r UTSW 7 67,833,186 (GRCm39) missense probably damaging 1.00
R9243:Igf1r UTSW 7 67,861,775 (GRCm39) missense probably benign 0.11
R9342:Igf1r UTSW 7 67,844,746 (GRCm39) missense probably benign 0.00
R9412:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R9525:Igf1r UTSW 7 67,864,682 (GRCm39) missense probably damaging 1.00
R9727:Igf1r UTSW 7 67,857,554 (GRCm39) missense probably damaging 1.00
R9730:Igf1r UTSW 7 67,839,423 (GRCm39) missense probably damaging 1.00
R9779:Igf1r UTSW 7 67,654,065 (GRCm39) missense probably damaging 1.00
RF025:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF032:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF034:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF037:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF039:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF044:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,916 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,930 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,928 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,922 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,918 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,921 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGAACTCCTACAAGGTCCCCTGTC -3'
(R):5'- GCTCCATGCACCCAAGTTACTACTC -3'

Sequencing Primer
(F):5'- TACAAGGTCCCCTGTCCAGAG -3'
(R):5'- GCGTTGCTAGGAAGACCTTTATC -3'
Posted On 2014-01-05