Incidental Mutation 'R1104:Igf1r'
ID 98363
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms line 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 039177-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1104 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 67952827-68233668 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68195026 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 849 (I849N)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000005671
AA Change: I849N

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: I849N

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Meta Mutation Damage Score 0.9251 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mark3 C T 12: 111,618,397 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Romanian UTSW 7 68004137 missense possibly damaging 0.94
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
R9057:Igf1r UTSW 7 68183438 missense probably damaging 1.00
R9243:Igf1r UTSW 7 68212027 missense probably benign 0.11
R9342:Igf1r UTSW 7 68194998 missense probably benign 0.00
R9412:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R9525:Igf1r UTSW 7 68214934 missense probably damaging 1.00
R9727:Igf1r UTSW 7 68207806 missense probably damaging 1.00
R9730:Igf1r UTSW 7 68189675 missense probably damaging 1.00
R9779:Igf1r UTSW 7 68004317 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGAACTCCTACAAGGTCCCCTGTC -3'
(R):5'- GCTCCATGCACCCAAGTTACTACTC -3'

Sequencing Primer
(F):5'- TACAAGGTCCCCTGTCCAGAG -3'
(R):5'- GCGTTGCTAGGAAGACCTTTATC -3'
Posted On 2014-01-05