Incidental Mutation 'R1105:Hs3st1'
ID98432
Institutional Source Beutler Lab
Gene Symbol Hs3st1
Ensembl Gene ENSMUSG00000051022
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 1
SynonymsD5Wsu110e, 3-OST
MMRRC Submission 039178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1105 (G1)
Quality Score105
Status Not validated
Chromosome5
Chromosomal Location39613935-39755475 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGTACAGGCTGCGGTTGAGAGCCTTGTA to GGTA at 39614698 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053116] [ENSMUST00000117944] [ENSMUST00000137142] [ENSMUST00000152057]
Predicted Effect probably benign
Transcript: ENSMUST00000053116
SMART Domains Protein: ENSMUSP00000051055
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117944
SMART Domains Protein: ENSMUSP00000113919
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137142
SMART Domains Protein: ENSMUSP00000114997
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 177 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152057
SMART Domains Protein: ENSMUSP00000118060
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1fmja_ 25 74 1e-5 SMART
PDB:1VKJ|C 40 75 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200697
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It possesses both heparan sulfate glucosaminyl 3-O-sulfotransferase activity, anticoagulant heparan sulfate conversion activity, and is a rate limiting enzyme for synthesis of anticoagulant heparan. This enzyme is an intraluminal Golgi resident protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth retardation and death between postnatal days 2-3 when bred on a C57BL/6J background. Mice homozygous for this mutation on a 129 background are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Bcl6 G T 16: 23,966,155 D698E probably benign Het
Catsperz A T 19: 6,924,935 Y64N probably benign Het
Clstn2 T C 9: 97,583,499 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Duox1 A T 2: 122,337,702 T1103S probably damaging Het
Gcfc2 T C 6: 81,939,453 S292P probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klk1b16 C T 7: 44,139,513 R57C probably damaging Het
Mki67 T C 7: 135,701,050 S752G probably benign Het
Ndrg1 T A 15: 66,940,231 N204Y probably damaging Het
Ripk1 T C 13: 34,028,167 Y487H probably benign Het
Rpl18a T C 8: 70,896,014 N77S probably damaging Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Hs3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Hs3st1 APN 5 39614757 missense probably damaging 1.00
IGL03162:Hs3st1 APN 5 39614449 nonsense probably null
R1539:Hs3st1 UTSW 5 39614448 missense probably benign
R1577:Hs3st1 UTSW 5 39615050 missense probably benign 0.01
R3857:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R3858:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R4730:Hs3st1 UTSW 5 39614805 nonsense probably null
R6091:Hs3st1 UTSW 5 39614664 missense probably damaging 1.00
R6194:Hs3st1 UTSW 5 39614405 missense probably damaging 0.96
R6213:Hs3st1 UTSW 5 39614521 missense probably damaging 1.00
R6292:Hs3st1 UTSW 5 39614790 missense possibly damaging 0.69
R7453:Hs3st1 UTSW 5 39614967 missense probably damaging 1.00
R8276:Hs3st1 UTSW 5 39614803 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCAGTAGAAGCCCTTGGTTTTG -3'
(R):5'- GGAGAAGACACCCGCCTATTTCAC -3'

Sequencing Primer
(F):5'- TTGTTAAAGTAGAAGTTCGAGGC -3'
(R):5'- TTCGCCCAAAGTGCCTGAG -3'
Posted On2014-01-05