Incidental Mutation 'R1106:Tas2r139'
ID98472
Institutional Source Beutler Lab
Gene Symbol Tas2r139
Ensembl Gene ENSMUSG00000047102
Gene Nametaste receptor, type 2, member 139
Synonymsmt2r34, Tas2r39
MMRRC Submission 039179-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1106 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42140936-42141895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42141545 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 204 (T204A)
Ref Sequence ENSEMBL: ENSMUSP00000062919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057686]
Predicted Effect probably benign
Transcript: ENSMUST00000057686
AA Change: T204A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062919
Gene: ENSMUSG00000047102
AA Change: T204A

DomainStartEndE-ValueType
Pfam:TAS2R 13 311 2.5e-64 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bitter taste receptor that detects green tea catechins, soy isoflavones, and theaflavins. The encoded protein is gustducin-linked and may activate alpha gustducin. This gene is intronless. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 C A 3: 82,004,590 F122L probably damaging Het
Caml A G 13: 55,624,725 T61A probably benign Het
Cfap20 A T 8: 95,421,245 I156N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dio2 A G 12: 90,738,211 L25P probably damaging Het
Eps8 G A 6: 137,514,324 P352L probably damaging Het
Gnai2 A G 9: 107,620,186 I3T probably damaging Het
Hexim2 T C 11: 103,138,493 S124P probably damaging Het
Klk1b16 C T 7: 44,139,513 R57C probably damaging Het
Mier3 A T 13: 111,708,229 D205V probably damaging Het
Olfr1189 T C 2: 88,592,011 V69A probably benign Het
Olfr1384 A G 11: 49,513,692 D18G probably damaging Het
Ptprz1 A G 6: 22,965,749 D192G probably damaging Het
Samd3 G A 10: 26,271,791 V455M possibly damaging Het
Slc9c1 C A 16: 45,555,807 Q419K possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Vps37a T A 8: 40,512,206 I33N probably damaging Het
Zfp335 TTGCTGCTGCTGCTGCTGCT TTGCTGCTGCTGCTGCT 2: 164,907,551 probably benign Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Tas2r139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Tas2r139 APN 6 42141121 missense probably damaging 1.00
IGL01593:Tas2r139 APN 6 42140957 missense probably benign 0.01
IGL01835:Tas2r139 APN 6 42141432 missense probably benign 0.21
IGL02990:Tas2r139 APN 6 42141104 missense probably damaging 1.00
R0517:Tas2r139 UTSW 6 42141491 missense probably damaging 0.98
R1352:Tas2r139 UTSW 6 42140940 missense probably benign 0.28
R4352:Tas2r139 UTSW 6 42141755 missense probably damaging 1.00
R4632:Tas2r139 UTSW 6 42141498 missense probably damaging 1.00
R4785:Tas2r139 UTSW 6 42141284 missense probably damaging 1.00
R4947:Tas2r139 UTSW 6 42141566 missense possibly damaging 0.82
R5888:Tas2r139 UTSW 6 42141496 missense probably damaging 1.00
R6796:Tas2r139 UTSW 6 42141592 missense probably damaging 1.00
R8058:Tas2r139 UTSW 6 42141819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATGTTCTTCAGCAAGCACAAGTTC -3'
(R):5'- AGTGGATGTCACGAGTCACATAAACAG -3'

Sequencing Primer
(F):5'- TTCACTGTGAACAACAACAATTCTC -3'
(R):5'- GAGACTGAAGATGCTTCCATGTTC -3'
Posted On2014-01-05