Incidental Mutation 'R1106:Vps37a'
ID98477
Institutional Source Beutler Lab
Gene Symbol Vps37a
Ensembl Gene ENSMUSG00000031600
Gene Namevacuolar protein sorting 37A
SynonymsD8Ertd531e, 4930592A21Rik, 2210018P21Rik
MMRRC Submission 039179-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R1106 (G1)
Quality Score135
Status Not validated
Chromosome8
Chromosomal Location40511783-40551134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40512206 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 33 (I33N)
Ref Sequence ENSEMBL: ENSMUSP00000096415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000135269] [ENSMUST00000149992]
Predicted Effect probably benign
Transcript: ENSMUST00000034012
SMART Domains Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 15 139 9.1e-15 PFAM
Pfam:CAF1 132 238 1.2e-14 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098817
AA Change: I33N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600
AA Change: I33N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Blast:UBCc 29 128 6e-6 BLAST
low complexity region 155 164 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Pfam:Mod_r 235 380 2.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128166
SMART Domains Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
Pfam:zf-DHHC 122 248 1.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128237
Predicted Effect probably benign
Transcript: ENSMUST00000132032
SMART Domains Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132740
Predicted Effect probably benign
Transcript: ENSMUST00000135269
SMART Domains Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 245 7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146280
Predicted Effect probably benign
Transcript: ENSMUST00000149992
SMART Domains Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164934
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 C A 3: 82,004,590 F122L probably damaging Het
Caml A G 13: 55,624,725 T61A probably benign Het
Cfap20 A T 8: 95,421,245 I156N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dio2 A G 12: 90,738,211 L25P probably damaging Het
Eps8 G A 6: 137,514,324 P352L probably damaging Het
Gnai2 A G 9: 107,620,186 I3T probably damaging Het
Hexim2 T C 11: 103,138,493 S124P probably damaging Het
Klk1b16 C T 7: 44,139,513 R57C probably damaging Het
Mier3 A T 13: 111,708,229 D205V probably damaging Het
Olfr1189 T C 2: 88,592,011 V69A probably benign Het
Olfr1384 A G 11: 49,513,692 D18G probably damaging Het
Ptprz1 A G 6: 22,965,749 D192G probably damaging Het
Samd3 G A 10: 26,271,791 V455M possibly damaging Het
Slc9c1 C A 16: 45,555,807 Q419K possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tas2r139 A G 6: 42,141,545 T204A probably benign Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Zfp335 TTGCTGCTGCTGCTGCTGCT TTGCTGCTGCTGCTGCT 2: 164,907,551 probably benign Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Vps37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Vps37a APN 8 40540738 missense probably benign 0.00
IGL01963:Vps37a APN 8 40540730 missense probably damaging 0.99
PIT4377001:Vps37a UTSW 8 40537046 missense possibly damaging 0.71
R0090:Vps37a UTSW 8 40526989 missense possibly damaging 0.92
R1815:Vps37a UTSW 8 40512121 missense probably benign
R3612:Vps37a UTSW 8 40544936 splice site probably benign
R5775:Vps37a UTSW 8 40529119 missense probably damaging 1.00
R5948:Vps37a UTSW 8 40540711 missense possibly damaging 0.64
R6048:Vps37a UTSW 8 40528322 missense probably damaging 1.00
R6337:Vps37a UTSW 8 40540708 missense probably benign 0.10
R6715:Vps37a UTSW 8 40540861 intron probably null
Predicted Primers PCR Primer
(F):5'- GCAGCAGGCCAGAACCTTGTAG -3'
(R):5'- CTGGCAAGTCCTAAGTGTGGAGC -3'

Sequencing Primer
(F):5'- AGGATGAGCTGGCTCTTTCC -3'
(R):5'- TTCGAAGGCAATGCTACAATCAG -3'
Posted On2014-01-05