Incidental Mutation 'R1106:Cfap20'
ID98478
Institutional Source Beutler Lab
Gene Symbol Cfap20
Ensembl Gene ENSMUSG00000031796
Gene Namecilia and flagella associated protein 20
SynonymsT10-2A2, 2600014O15Rik, Gtl3
MMRRC Submission 039179-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1106 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95420249-95434869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95421245 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 156 (I156N)
Ref Sequence ENSEMBL: ENSMUSP00000034249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034249] [ENSMUST00000211908] [ENSMUST00000212131] [ENSMUST00000212684] [ENSMUST00000213086]
Predicted Effect probably damaging
Transcript: ENSMUST00000034249
AA Change: I156N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034249
Gene: ENSMUSG00000031796
AA Change: I156N

DomainStartEndE-ValueType
Pfam:DUF667 1 185 1.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211908
Predicted Effect probably benign
Transcript: ENSMUST00000212131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212579
Predicted Effect probably benign
Transcript: ENSMUST00000212684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212807
Predicted Effect probably benign
Transcript: ENSMUST00000213086
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 C A 3: 82,004,590 F122L probably damaging Het
Caml A G 13: 55,624,725 T61A probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dio2 A G 12: 90,738,211 L25P probably damaging Het
Eps8 G A 6: 137,514,324 P352L probably damaging Het
Gnai2 A G 9: 107,620,186 I3T probably damaging Het
Hexim2 T C 11: 103,138,493 S124P probably damaging Het
Klk1b16 C T 7: 44,139,513 R57C probably damaging Het
Mier3 A T 13: 111,708,229 D205V probably damaging Het
Olfr1189 T C 2: 88,592,011 V69A probably benign Het
Olfr1384 A G 11: 49,513,692 D18G probably damaging Het
Ptprz1 A G 6: 22,965,749 D192G probably damaging Het
Samd3 G A 10: 26,271,791 V455M possibly damaging Het
Slc9c1 C A 16: 45,555,807 Q419K possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tas2r139 A G 6: 42,141,545 T204A probably benign Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Vps37a T A 8: 40,512,206 I33N probably damaging Het
Zfp335 TTGCTGCTGCTGCTGCTGCT TTGCTGCTGCTGCTGCT 2: 164,907,551 probably benign Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Cfap20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Cfap20 APN 8 95424659 missense probably damaging 1.00
R4182:Cfap20 UTSW 8 95424656 missense probably damaging 1.00
R4746:Cfap20 UTSW 8 95422056 critical splice donor site probably null
R7115:Cfap20 UTSW 8 95421246 missense probably benign 0.00
R7150:Cfap20 UTSW 8 95422167 missense probably damaging 0.99
Z1176:Cfap20 UTSW 8 95434525 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCGCTTGCTCATTAGCCTTTGAGAC -3'
(R):5'- GAATCCTCCTACTGTTGGAATCCACG -3'

Sequencing Primer
(F):5'- TGGCACTGCCACACTGTAAG -3'
(R):5'- TGTTGGAATCCACGCCAGG -3'
Posted On2014-01-05