Incidental Mutation 'R1107:Fam208a'
ID98525
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 039180-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1107 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 27479723 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 49 (Q49*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450] [ENSMUST00000050480] [ENSMUST00000223689]
Predicted Effect probably null
Transcript: ENSMUST00000022450
AA Change: Q1397*
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: Q1397*

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050480
SMART Domains Protein: ENSMUSP00000052546
Gene: ENSMUSG00000046753

DomainStartEndE-ValueType
coiled coil region 252 284 N/A INTRINSIC
Pfam:CCDC66 409 561 1e-49 PFAM
low complexity region 715 721 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224837
Predicted Effect probably null
Transcript: ENSMUST00000225139
AA Change: Q49*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T C 6: 39,585,785 V530A possibly damaging Het
Apba2 G A 7: 64,745,719 V636I possibly damaging Het
Cacna1b G A 2: 24,697,603 A625V probably damaging Het
Ccdc134 C A 15: 82,134,691 R141S possibly damaging Het
Ccdc134 T A 15: 82,134,694 W142R probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlg1 A G 16: 31,846,916 E697G probably benign Het
Fezf2 A T 14: 12,342,624 C414S probably damaging Het
Kif26b A C 1: 178,917,673 N1778T probably benign Het
Lrp1 T C 10: 127,557,435 Y2683C probably damaging Het
Mroh7 T C 4: 106,707,594 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pclo T A 5: 14,677,869 probably benign Het
Rnf220 C A 4: 117,285,390 G114V probably damaging Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
R7580:Fam208a UTSW 14 27466286 missense probably benign 0.29
R7726:Fam208a UTSW 14 27447497 missense probably damaging 0.99
R7771:Fam208a UTSW 14 27467559 missense probably damaging 1.00
R7782:Fam208a UTSW 14 27471944 missense probably benign 0.07
R7795:Fam208a UTSW 14 27481383 missense
R7835:Fam208a UTSW 14 27476643 missense probably damaging 1.00
R7954:Fam208a UTSW 14 27447524 critical splice donor site probably null
R7981:Fam208a UTSW 14 27446416 missense possibly damaging 0.49
R8101:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R8160:Fam208a UTSW 14 27449956 missense probably damaging 1.00
R8307:Fam208a UTSW 14 27471665 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Z1176:Fam208a UTSW 14 27429208 missense probably damaging 0.97
Z1176:Fam208a UTSW 14 27477148 missense probably damaging 1.00
Z1177:Fam208a UTSW 14 27448250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGTCAGATGCACAATTCCCAT -3'
(R):5'- GGGACTCAAGGTTCTCATTAGCACC -3'

Sequencing Primer
(F):5'- gcctcaaactcagaaatccac -3'
(R):5'- ACTGAGTTGTGATAGCCCAC -3'
Posted On2014-01-05