Incidental Mutation 'R1108:Olfr564'
ID98553
Institutional Source Beutler Lab
Gene Symbol Olfr564
Ensembl Gene ENSMUSG00000048469
Gene Nameolfactory receptor 564
SynonymsGA_x6K02T2PBJ9-5513635-5514627, MOR14-10
MMRRC Submission 039181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1108 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102803480-102804430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102803850 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 124 (R124H)
Ref Sequence ENSEMBL: ENSMUSP00000129376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061096]
Predicted Effect probably benign
Transcript: ENSMUST00000061096
AA Change: R124H

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129376
Gene: ENSMUSG00000048469
AA Change: R124H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.6e-117 PFAM
Pfam:7TM_GPCR_Srsx 38 256 4.7e-8 PFAM
Pfam:7tm_1 43 294 2.5e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Calb2 T A 8: 110,143,128 R258* probably null Het
Cep128 T A 12: 91,339,109 E173D probably damaging Het
Cndp2 A G 18: 84,675,060 C192R probably damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Esrrb G A 12: 86,505,830 R182Q probably damaging Het
Fgf22 T C 10: 79,756,583 I58T probably damaging Het
Flcn A G 11: 59,801,200 F208L possibly damaging Het
Fras1 G A 5: 96,642,629 C954Y probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kmt2a G T 9: 44,849,062 L530I probably damaging Het
Man1c1 T C 4: 134,564,613 E548G probably damaging Het
Myh4 T G 11: 67,255,706 L1502V probably null Het
Olfr868 A C 9: 20,100,825 D22A probably benign Het
Pak4 A G 7: 28,560,242 M510T probably damaging Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Svs6 T C 2: 164,317,660 probably null Het
Teddm1a T C 1: 153,892,320 W177R probably damaging Het
Trank1 A G 9: 111,365,307 R800G probably benign Het
Zfp971 C T 2: 178,033,670 P354L probably damaging Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Olfr564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Olfr564 APN 7 102803854 nonsense probably null
IGL03248:Olfr564 APN 7 102803639 nonsense probably null
R1395:Olfr564 UTSW 7 102804207 missense possibly damaging 0.90
R1422:Olfr564 UTSW 7 102803850 missense probably benign 0.08
R4032:Olfr564 UTSW 7 102804189 missense probably benign 0.00
R5168:Olfr564 UTSW 7 102804321 missense probably benign
R5269:Olfr564 UTSW 7 102804120 missense probably benign
R5639:Olfr564 UTSW 7 102803993 missense probably benign
R5930:Olfr564 UTSW 7 102804274 missense probably damaging 1.00
R6019:Olfr564 UTSW 7 102804284 nonsense probably null
R7206:Olfr564 UTSW 7 102803684 missense probably damaging 1.00
R7254:Olfr564 UTSW 7 102803558 missense probably benign
R7845:Olfr564 UTSW 7 102804285 missense not run
R7928:Olfr564 UTSW 7 102804285 missense not run
R8036:Olfr564 UTSW 7 102803556 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TATGCAACTGCCCTGTCAGGGAAC -3'
(R):5'- AGTGATGAAGCACATGGCTGCTAC -3'

Sequencing Primer
(F):5'- TGTCAGGGAACAGCCTGATTC -3'
(R):5'- CATGGCTGCTACAGTAGGATAATC -3'
Posted On2014-01-05