Incidental Mutation 'R1109:Il1f6'
ID98595
Institutional Source Beutler Lab
Gene Symbol Il1f6
Ensembl Gene ENSMUSG00000026984
Gene Nameinterleukin 1 family, member 6
SynonymsFil1, IL-1H1, Fil1epsilon
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24215418-24225702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24216590 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 62 (G62E)
Ref Sequence ENSEMBL: ENSMUSP00000028361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028361]
Predicted Effect probably damaging
Transcript: ENSMUST00000028361
AA Change: G62E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028361
Gene: ENSMUSG00000026984
AA Change: G62E

DomainStartEndE-ValueType
IL1 14 157 4.09e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144442
Meta Mutation Damage Score 0.4759 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that can activate NF-kappa-B and MAPK signaling pathways to generate an inflammatory response. The encoded protein functions primarily in skin and demonstrates increased expression in psoriasis. In addition, decreased expression of this gene has been linked to a poor prognosis in both hepatocellular carcinoma and colorectal cancer patients. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Il1f6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Il1f6 APN 2 24216580 missense probably benign 0.21
R4657:Il1f6 UTSW 2 24224404 missense possibly damaging 0.54
R4879:Il1f6 UTSW 2 24216020 missense probably benign 0.06
R5213:Il1f6 UTSW 2 24224474 missense probably damaging 1.00
R6555:Il1f6 UTSW 2 24224599 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGATGCCTCTCTGAGCCCA -3'
(R):5'- AGGAAGATTATCCAGTGCCAATCTGACT -3'

Sequencing Primer
(F):5'- ACTGGTGTGTGGCAGTGAC -3'
(R):5'- GGAGAGTTGGTTTAAAAAAATCCCC -3'
Posted On2014-01-05