Mutagenetix > Incidental Mutations

Incidental Mutation 'R1109:Trpm7'

98601

Institutional Source

Beutler Lab

Gene Symbol

Trpm7

Ensembl Gene

ENSMUSG00000027365

Gene Name

transient receptor potential cation channel, subfamily M, member 7

Synonyms

LTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK

MMRRC Submission

039182-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1109 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126791565-126876230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 126797793 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 1628 (L1628M)

Ref Sequence

ENSEMBL: ENSMUSP00000099513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]

PDB Structure

CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028843
AA Change: L1627M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: L1627M

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
Pfam:Ion_trans	887	1096	3e-8	PFAM
PDB:3E7K\|H	1198	1249	6e-27	PDB
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1545	6e-64	BLAST
Alpha_kinase	1596	1813	3.77e-89	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000103224
AA Change: L1628M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: L1628M

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
Pfam:Ion_trans	855	1108	1.7e-9	PFAM
Pfam:TRPM_tetra	1194	1249	3.3e-29	PFAM
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1546	2e-64	BLAST
Alpha_kinase	1597	1814	3.77e-89	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135733

Predicted Effect

unknown
Transcript: ENSMUST00000136964
AA Change: L18M

SMART Domains

Protein: ENSMUSP00000119232
Gene: ENSMUSG00000027365
AA Change: L18M

Domain	Start	End	E-Value	Type
Alpha_kinase	1	242	8e-61	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155675

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 88.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	T	7: 118,775,329	I351F	probably damaging	Het
Abcd3	T	G	3: 121,779,596	E262D	probably damaging	Het
Abcg1	G	A	17: 31,111,236	A504T	probably benign	Het
Acot11	T	C	4: 106,749,348	T515A	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Arhgap44	T	A	11: 65,026,816	H375L	probably benign	Het
Aspm	A	T	1: 139,456,758	I98F	probably damaging	Het
Atp8b5	T	C	4: 43,305,719		probably benign	Het
Ccdc129	G	T	6: 55,968,260	K655N	probably damaging	Het
Coa3	T	C	11: 101,278,785	K48R	probably damaging	Het
Col12a1	A	G	9: 79,699,723	S473P	probably damaging	Het
Dnmt1	A	T	9: 20,922,388	Y451N	probably damaging	Het
Dock5	A	G	14: 67,806,478	Y819H	possibly damaging	Het
Dtx1	G	A	5: 120,710,419		probably benign	Het
Dus2	T	A	8: 106,053,482	F479I	probably benign	Het
Esrp1	T	C	4: 11,365,205	E262G	probably damaging	Het
Exoc4	A	G	6: 33,442,016	Y466C	probably damaging	Het
Fasn	A	G	11: 120,812,324	F1625S	possibly damaging	Het
Fbxw25	A	T	9: 109,650,060	H374Q	probably benign	Het
Focad	T	C	4: 88,196,747		probably benign	Het
Gad2	G	T	2: 22,681,394	R448L	probably damaging	Het
Gad2	G	A	2: 22,690,159		probably benign	Het
Galnt16	G	T	12: 80,590,631	E377D	probably benign	Het
Gcc1	A	C	6: 28,419,167	L389R	probably damaging	Het
Ggct	A	T	6: 54,989,569		probably benign	Het
Gm7052	G	A	17: 22,040,152		probably benign	Het
Gps2	T	A	11: 69,915,681	H177Q	possibly damaging	Het
Heg1	T	A	16: 33,763,591	L1256Q	probably damaging	Het
Ikbkap	T	C	4: 56,786,723	T407A	probably benign	Het
Il1f6	G	A	2: 24,216,590	G62E	probably damaging	Het
Il3ra	C	T	14: 14,349,317	R138W	probably damaging	Het
Kdm4b	T	A	17: 56,399,430	I848N	probably damaging	Het
L3hypdh	A	G	12: 72,073,996	V327A	possibly damaging	Het
Lepr	G	T	4: 101,771,355	L552F	probably damaging	Het
Lpin3	T	C	2: 160,899,021	I449T	probably damaging	Het
Lrrn1	A	G	6: 107,567,264	K8E	probably benign	Het
Mex3a	G	T	3: 88,536,660	D348Y	possibly damaging	Het
Mindy2	G	A	9: 70,631,079	R325*	probably null	Het
Mkrn1	A	T	6: 39,399,334	M382K	probably damaging	Het
Mroh1	G	T	15: 76,446,509		probably benign	Het
Myo15	T	A	11: 60,493,066	D1646E	probably damaging	Het
Neu2	A	G	1: 87,596,728	D145G	probably damaging	Het
Olfr317	T	C	11: 58,732,916	Y83C	probably benign	Het
Olfr718-ps1	A	T	5: 143,137,619	N216K	probably benign	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Plekhm2	T	A	4: 141,627,984	I938F	probably benign	Het
Pnmal1	A	T	7: 16,961,467	K416*	probably null	Het
Ppid	T	C	3: 79,598,861	S198P	probably benign	Het
Rabl6	G	T	2: 25,587,526	P304Q	probably damaging	Het
Rasal2	A	T	1: 157,177,638		probably benign	Het
Ripor1	G	T	8: 105,618,928		probably benign	Het
Rnf216	A	T	5: 143,068,369	L658Q	probably damaging	Het
Rnf219	A	T	14: 104,479,764	L391*	probably null	Het
Safb	T	A	17: 56,601,228		probably benign	Het
Sf3b5	T	C	10: 13,008,753	M44T	probably benign	Het
Slc26a9	A	T	1: 131,758,798	M419L	probably benign	Het
Slc38a8	T	C	8: 119,482,655	D393G	probably benign	Het
Slc6a3	A	G	13: 73,557,080	D230G	probably benign	Het
Smc1b	T	C	15: 85,112,815	T535A	probably damaging	Het
Smg7	G	C	1: 152,845,583	P626R	probably damaging	Het
Smu1	C	T	4: 40,755,722	V48M	probably benign	Het
Spag17	T	C	3: 100,027,351	Y650H	possibly damaging	Het
Spata1	C	T	3: 146,475,298	V302I	possibly damaging	Het
Sptb	G	A	12: 76,603,603	A1780V	probably damaging	Het
Srrm2	G	A	17: 23,819,617		probably benign	Het
Sspo	A	C	6: 48,497,443	N4933H	probably damaging	Het
Sult2a2	T	C	7: 13,734,873	I88T	probably benign	Het
Tgfa	G	T	6: 86,270,090		probably benign	Het
Thsd1	T	A	8: 22,243,692	C252S	possibly damaging	Het
Tmem102	T	A	11: 69,804,804	H114L	probably damaging	Het
Tnni3k	T	A	3: 154,792,777	K808N	possibly damaging	Het
Ttn	A	G	2: 76,730,737	Y29107H	probably damaging	Het
Upb1	T	C	10: 75,438,165	L342P	probably damaging	Het
Vmn2r120	T	C	17: 57,525,829	T117A	probably benign	Het
Vmn2r16	A	G	5: 109,339,786	D175G	probably damaging	Het
Zfhx4	T	G	3: 5,399,870	M1696R	possibly damaging	Het
Zfp746	A	G	6: 48,064,922	V289A	possibly damaging	Het
Zfyve26	A	C	12: 79,272,127	F1146V	probably damaging	Het

Other mutations in Trpm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Trpm7	APN	2	126829031	missense	possibly damaging	0.82
IGL01084:Trpm7	APN	2	126846072	critical splice donor site	probably null
IGL01634:Trpm7	APN	2	126826818	missense	probably damaging	1.00
IGL01678:Trpm7	APN	2	126816799	missense	probably damaging	0.99
IGL02005:Trpm7	APN	2	126813184	missense	probably damaging	0.97
IGL02064:Trpm7	APN	2	126797943	missense	probably damaging	1.00
IGL02156:Trpm7	APN	2	126799243	unclassified	probably benign
IGL02172:Trpm7	APN	2	126795328	missense	possibly damaging	0.94
IGL02334:Trpm7	APN	2	126807362	missense	probably benign
IGL02375:Trpm7	APN	2	126825744	missense	probably damaging	1.00
IGL02388:Trpm7	APN	2	126819891	missense	possibly damaging	0.80
IGL02552:Trpm7	APN	2	126840779	missense	probably damaging	1.00
IGL02684:Trpm7	APN	2	126846159	missense	probably damaging	0.99
IGL02901:Trpm7	APN	2	126807287	critical splice donor site	probably null
Accused	UTSW	2	126826737	missense	probably damaging	0.99
Condemned	UTSW	2	126835508	missense	probably damaging	1.00
P0037:Trpm7	UTSW	2	126816757	splice site	probably benign
R0038:Trpm7	UTSW	2	126795468	missense	probably damaging	1.00
R0139:Trpm7	UTSW	2	126812771	missense	probably benign
R0165:Trpm7	UTSW	2	126797513	missense	probably damaging	0.97
R0511:Trpm7	UTSW	2	126826718	nonsense	probably null
R0543:Trpm7	UTSW	2	126848529	missense	probably damaging	1.00
R0784:Trpm7	UTSW	2	126846072	critical splice donor site	probably null
R0844:Trpm7	UTSW	2	126835508	missense	probably damaging	1.00
R0865:Trpm7	UTSW	2	126799239	splice site	probably null
R0919:Trpm7	UTSW	2	126831238	missense	probably damaging	1.00
R0972:Trpm7	UTSW	2	126805049	missense	probably benign
R1118:Trpm7	UTSW	2	126822486	missense	possibly damaging	0.63
R1278:Trpm7	UTSW	2	126825454	nonsense	probably null
R1527:Trpm7	UTSW	2	126830162	missense	probably benign	0.18
R1542:Trpm7	UTSW	2	126822599	nonsense	probably null
R1882:Trpm7	UTSW	2	126812777	missense	probably benign	0.00
R1951:Trpm7	UTSW	2	126831299	missense	probably damaging	1.00
R2011:Trpm7	UTSW	2	126823997	nonsense	probably null
R2012:Trpm7	UTSW	2	126823997	nonsense	probably null
R2026:Trpm7	UTSW	2	126812738	missense	probably benign	0.39
R2067:Trpm7	UTSW	2	126797727	missense	probably damaging	1.00
R2926:Trpm7	UTSW	2	126858409	splice site	probably benign
R3082:Trpm7	UTSW	2	126844422	missense	possibly damaging	0.90
R3552:Trpm7	UTSW	2	126826710	splice site	probably benign
R3607:Trpm7	UTSW	2	126796428	intron	probably benign
R3739:Trpm7	UTSW	2	126851521	missense	probably damaging	1.00
R3943:Trpm7	UTSW	2	126831218	missense	possibly damaging	0.94
R4161:Trpm7	UTSW	2	126816831	missense	probably damaging	1.00
R4176:Trpm7	UTSW	2	126829163	missense	possibly damaging	0.83
R4392:Trpm7	UTSW	2	126795509	splice site	probably null
R4392:Trpm7	UTSW	2	126848538	missense	probably damaging	1.00
R4404:Trpm7	UTSW	2	126833715	missense	probably damaging	0.97
R4574:Trpm7	UTSW	2	126797211	missense	probably benign	0.01
R4714:Trpm7	UTSW	2	126840783	nonsense	probably null
R4807:Trpm7	UTSW	2	126831229	missense	probably benign	0.00
R4815:Trpm7	UTSW	2	126858492	missense	probably damaging	1.00
R4846:Trpm7	UTSW	2	126813185	missense	possibly damaging	0.63
R4972:Trpm7	UTSW	2	126824058	missense	probably damaging	1.00
R5097:Trpm7	UTSW	2	126796336	critical splice donor site	probably null
R5263:Trpm7	UTSW	2	126821217	missense	probably benign	0.34
R5361:Trpm7	UTSW	2	126829241	missense	possibly damaging	0.77
R5377:Trpm7	UTSW	2	126842855	critical splice donor site	probably null
R5574:Trpm7	UTSW	2	126813030	missense	probably benign
R5782:Trpm7	UTSW	2	126797714	missense	probably benign	0.04
R5840:Trpm7	UTSW	2	126822611	nonsense	probably null
R6044:Trpm7	UTSW	2	126814745	missense	probably damaging	1.00
R6178:Trpm7	UTSW	2	126837381	missense	probably damaging	1.00
R6196:Trpm7	UTSW	2	126825639	missense	possibly damaging	0.66
R6457:Trpm7	UTSW	2	126807294	missense	probably benign
R6530:Trpm7	UTSW	2	126812711	missense	probably damaging	1.00
R6764:Trpm7	UTSW	2	126844420	missense	possibly damaging	0.79
R6841:Trpm7	UTSW	2	126813021	missense	probably benign	0.00
R6868:Trpm7	UTSW	2	126837414	missense	probably damaging	1.00
R7250:Trpm7	UTSW	2	126826765	missense	possibly damaging	0.87
R7402:Trpm7	UTSW	2	126799206	missense	probably damaging	1.00
R7451:Trpm7	UTSW	2	126826737	missense	probably damaging	0.99
R7486:Trpm7	UTSW	2	126831195	critical splice donor site	probably null
R7509:Trpm7	UTSW	2	126849922	missense	probably damaging	1.00
R7586:Trpm7	UTSW	2	126810165	missense	probably benign
R7774:Trpm7	UTSW	2	126813238	missense	probably benign	0.09
R7793:Trpm7	UTSW	2	126824075	nonsense	probably null
R7812:Trpm7	UTSW	2	126799316	missense	probably damaging	1.00
R7900:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R7951:Trpm7	UTSW	2	126813268	missense	possibly damaging	0.94
R7965:Trpm7	UTSW	2	126825694	missense	probably damaging	0.99
R7992:Trpm7	UTSW	2	126825534	missense	probably benign
R8034:Trpm7	UTSW	2	126846199	missense	probably damaging	0.98
R8199:Trpm7	UTSW	2	126849998	missense	probably damaging	1.00
R8304:Trpm7	UTSW	2	126797877	missense	probably damaging	1.00
R8405:Trpm7	UTSW	2	126816835	missense	probably benign	0.26
X0026:Trpm7	UTSW	2	126829290	missense	probably benign
Z1088:Trpm7	UTSW	2	126797281	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCTTACAGTCAAGTTCACTGACAC -3'
(R):5'- AAGTAGCACTGGGTTACCGTTGCC -3'

Sequencing Primer
(F):5'- CTGACACTTACTCTGAGACAGAGATG -3'
(R):5'- GGTTTGCCCAACAAACATTTTATCC -3'

Posted On

2014-01-05