Incidental Mutation 'R1109:Lpin3'
ID98602
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Namelipin 3
Synonyms9130206L11Rik
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160880670-160906002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160899021 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 449 (I449T)
Ref Sequence ENSEMBL: ENSMUSP00000105081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably damaging
Transcript: ENSMUST00000040872
AA Change: I449T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: I449T

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109455
AA Change: I449T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: I449T

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109456
AA Change: I449T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: I449T

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109457
AA Change: I449T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: I449T

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Meta Mutation Damage Score 0.5521 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160893998 missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160903729 missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160897127 missense probably benign 0.02
IGL02124:Lpin3 APN 2 160895833 critical splice donor site probably null
IGL02272:Lpin3 APN 2 160901661 missense probably benign 0.15
IGL02314:Lpin3 APN 2 160898718 nonsense probably null
IGL02374:Lpin3 APN 2 160895838 splice site probably benign
IGL02554:Lpin3 APN 2 160896787 missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160905055 missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160898620 splice site probably benign
IGL03143:Lpin3 APN 2 160903598 splice site probably benign
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160905305 missense probably benign
R0330:Lpin3 UTSW 2 160905305 missense probably benign
R0570:Lpin3 UTSW 2 160904024 splice site probably benign
R0633:Lpin3 UTSW 2 160903974 missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1110:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1513:Lpin3 UTSW 2 160904548 missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160896809 nonsense probably null
R1786:Lpin3 UTSW 2 160896809 nonsense probably null
R1896:Lpin3 UTSW 2 160905298 missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160898645 missense probably benign
R4470:Lpin3 UTSW 2 160895434 missense probably benign 0.00
R4996:Lpin3 UTSW 2 160905287 missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160904828 missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160897061 missense probably benign
R5184:Lpin3 UTSW 2 160897138 missense probably benign
R5405:Lpin3 UTSW 2 160903929 missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160905016 missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160897330 missense probably benign
R5670:Lpin3 UTSW 2 160897330 missense probably benign
R5693:Lpin3 UTSW 2 160895400 missense probably benign 0.00
R6084:Lpin3 UTSW 2 160895801 missense probably benign 0.38
R6994:Lpin3 UTSW 2 160904883 missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160896752 missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160898707 missense probably benign 0.02
R7207:Lpin3 UTSW 2 160894003 nonsense probably null
R7430:Lpin3 UTSW 2 160898666 missense probably benign 0.06
R7459:Lpin3 UTSW 2 160897300 missense probably benign 0.06
R7644:Lpin3 UTSW 2 160896770 missense probably benign 0.02
R7706:Lpin3 UTSW 2 160905290 missense probably damaging 1.00
X0002:Lpin3 UTSW 2 160903717 missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160892231 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTCCCTGAAGAGAAACCAGCAC -3'
(R):5'- ATGGGCACCACAGGACAGCTAATG -3'

Sequencing Primer
(F):5'- AAAGGCTTCCTATCAAGGGTCTG -3'
(R):5'- TCTGTGGTGACCCCTGAAG -3'
Posted On2014-01-05