Incidental Mutation 'R1109:Tnni3k'
ID98613
Institutional Source Beutler Lab
Gene Symbol Tnni3k
Ensembl Gene ENSMUSG00000040086
Gene NameTNNI3 interacting kinase
SynonymsCark, D830019J24Rik
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154786291-155055407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154792777 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 808 (K808N)
Ref Sequence ENSEMBL: ENSMUSP00000070561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064076
AA Change: K808N

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086
AA Change: K808N

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 718 6.7e-48 PFAM
Pfam:Pkinase_Tyr 462 718 2.1e-59 PFAM
low complexity region 727 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143410
SMART Domains Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 674 3.5e-48 PFAM
Pfam:Pkinase_Tyr 462 674 3.6e-52 PFAM
Meta Mutation Damage Score 0.0941 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Tnni3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tnni3k APN 3 155054555 missense probably benign 0.00
IGL00852:Tnni3k APN 3 155054569 missense probably benign 0.00
IGL01090:Tnni3k APN 3 154939683 missense possibly damaging 0.69
IGL01593:Tnni3k APN 3 154941029 splice site probably null
IGL01724:Tnni3k APN 3 154939626 missense possibly damaging 0.53
IGL01887:Tnni3k APN 3 154875187 splice site probably null
IGL01992:Tnni3k APN 3 154962026 missense probably damaging 0.99
IGL02945:Tnni3k APN 3 155037438 missense possibly damaging 0.48
IGL02990:Tnni3k APN 3 154957758 missense probably benign 0.01
IGL03069:Tnni3k APN 3 154941605 splice site probably null
IGL03325:Tnni3k APN 3 154961814 missense probably damaging 1.00
IGL03405:Tnni3k APN 3 154792767 splice site probably benign
R0211:Tnni3k UTSW 3 155055344 start gained probably benign
R0682:Tnni3k UTSW 3 154940028 missense probably damaging 1.00
R0693:Tnni3k UTSW 3 154961972 missense probably damaging 1.00
R0907:Tnni3k UTSW 3 154941679 missense probably damaging 1.00
R1180:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1181:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1476:Tnni3k UTSW 3 155030305 missense probably benign 0.05
R1496:Tnni3k UTSW 3 154939658 missense probably damaging 1.00
R1687:Tnni3k UTSW 3 154939626 missense possibly damaging 0.53
R1704:Tnni3k UTSW 3 154827508 missense probably benign 0.27
R1913:Tnni3k UTSW 3 154979199 missense probably benign 0.00
R2343:Tnni3k UTSW 3 154938829 missense probably benign 0.00
R2374:Tnni3k UTSW 3 154786785 missense probably benign 0.12
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2873:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R4858:Tnni3k UTSW 3 154786808 splice site probably null
R5597:Tnni3k UTSW 3 154872128 missense probably damaging 1.00
R5806:Tnni3k UTSW 3 154827611 missense possibly damaging 0.88
R5871:Tnni3k UTSW 3 155030370 missense probably benign 0.23
R6467:Tnni3k UTSW 3 154969285 missense probably damaging 0.97
R6475:Tnni3k UTSW 3 154941058 nonsense probably null
R6882:Tnni3k UTSW 3 154957720 missense possibly damaging 0.49
R6976:Tnni3k UTSW 3 154792776 missense probably benign 0.14
R6986:Tnni3k UTSW 3 154961864 missense probably damaging 1.00
R7207:Tnni3k UTSW 3 154875145 missense probably damaging 1.00
R7539:Tnni3k UTSW 3 154962031 missense probably benign 0.01
Z1088:Tnni3k UTSW 3 154939670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGGAGGGCCAGAGATTATTAC -3'
(R):5'- AACCGAATCTCGTTGACCTCGC -3'

Sequencing Primer
(F):5'- cacacacattctctcacacatac -3'
(R):5'- GACCTCGCGTTGACATTTC -3'
Posted On2014-01-05