Incidental Mutation 'R1109:Focad'
ID98619
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 88196747 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect probably benign
Transcript: ENSMUST00000097992
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159342
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AATTGTCCTGTGTCCAAGTCTGCC -3'
(R):5'- TGGTGACCCTCAGTATCTGCTGAAG -3'

Sequencing Primer
(F):5'- TTCGAGCTGCCACTTACAAGG -3'
(R):5'- AGTATCTGCTGAAGATTCTGCC -3'
Posted On2014-01-05