Mutagenetix > Incidental Mutations

Incidental Mutation 'R1109:Rnf216'

98632

Institutional Source

Beutler Lab

Gene Symbol

Rnf216

Ensembl Gene

ENSMUSG00000045078

Gene Name

ring finger protein 216

Synonyms

2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83

MMRRC Submission

039182-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1109 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

142990893-143112994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 143068369 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 658 (L658Q)

Ref Sequence

ENSEMBL: ENSMUSP00000143705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053498
AA Change: L601Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: L601Q

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200421

Predicted Effect

probably benign
Transcript: ENSMUST00000200430

Predicted Effect

probably damaging
Transcript: ENSMUST00000200607
AA Change: L658Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: L658Q

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Meta Mutation Damage Score

0.7337

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 88.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	T	7: 118,775,329	I351F	probably damaging	Het
Abcd3	T	G	3: 121,779,596	E262D	probably damaging	Het
Abcg1	G	A	17: 31,111,236	A504T	probably benign	Het
Acot11	T	C	4: 106,749,348	T515A	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Arhgap44	T	A	11: 65,026,816	H375L	probably benign	Het
Aspm	A	T	1: 139,456,758	I98F	probably damaging	Het
Atp8b5	T	C	4: 43,305,719		probably benign	Het
Ccdc129	G	T	6: 55,968,260	K655N	probably damaging	Het
Coa3	T	C	11: 101,278,785	K48R	probably damaging	Het
Col12a1	A	G	9: 79,699,723	S473P	probably damaging	Het
Dnmt1	A	T	9: 20,922,388	Y451N	probably damaging	Het
Dock5	A	G	14: 67,806,478	Y819H	possibly damaging	Het
Dtx1	G	A	5: 120,710,419		probably benign	Het
Dus2	T	A	8: 106,053,482	F479I	probably benign	Het
Esrp1	T	C	4: 11,365,205	E262G	probably damaging	Het
Exoc4	A	G	6: 33,442,016	Y466C	probably damaging	Het
Fasn	A	G	11: 120,812,324	F1625S	possibly damaging	Het
Fbxw25	A	T	9: 109,650,060	H374Q	probably benign	Het
Focad	T	C	4: 88,196,747		probably benign	Het
Gad2	G	T	2: 22,681,394	R448L	probably damaging	Het
Gad2	G	A	2: 22,690,159		probably benign	Het
Galnt16	G	T	12: 80,590,631	E377D	probably benign	Het
Gcc1	A	C	6: 28,419,167	L389R	probably damaging	Het
Ggct	A	T	6: 54,989,569		probably benign	Het
Gm7052	G	A	17: 22,040,152		probably benign	Het
Gps2	T	A	11: 69,915,681	H177Q	possibly damaging	Het
Heg1	T	A	16: 33,763,591	L1256Q	probably damaging	Het
Ikbkap	T	C	4: 56,786,723	T407A	probably benign	Het
Il1f6	G	A	2: 24,216,590	G62E	probably damaging	Het
Il3ra	C	T	14: 14,349,317	R138W	probably damaging	Het
Kdm4b	T	A	17: 56,399,430	I848N	probably damaging	Het
L3hypdh	A	G	12: 72,073,996	V327A	possibly damaging	Het
Lepr	G	T	4: 101,771,355	L552F	probably damaging	Het
Lpin3	T	C	2: 160,899,021	I449T	probably damaging	Het
Lrrn1	A	G	6: 107,567,264	K8E	probably benign	Het
Mex3a	G	T	3: 88,536,660	D348Y	possibly damaging	Het
Mindy2	G	A	9: 70,631,079	R325*	probably null	Het
Mkrn1	A	T	6: 39,399,334	M382K	probably damaging	Het
Mroh1	G	T	15: 76,446,509		probably benign	Het
Myo15	T	A	11: 60,493,066	D1646E	probably damaging	Het
Neu2	A	G	1: 87,596,728	D145G	probably damaging	Het
Olfr317	T	C	11: 58,732,916	Y83C	probably benign	Het
Olfr718-ps1	A	T	5: 143,137,619	N216K	probably benign	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Plekhm2	T	A	4: 141,627,984	I938F	probably benign	Het
Pnmal1	A	T	7: 16,961,467	K416*	probably null	Het
Ppid	T	C	3: 79,598,861	S198P	probably benign	Het
Rabl6	G	T	2: 25,587,526	P304Q	probably damaging	Het
Rasal2	A	T	1: 157,177,638		probably benign	Het
Ripor1	G	T	8: 105,618,928		probably benign	Het
Rnf219	A	T	14: 104,479,764	L391*	probably null	Het
Safb	T	A	17: 56,601,228		probably benign	Het
Sf3b5	T	C	10: 13,008,753	M44T	probably benign	Het
Slc26a9	A	T	1: 131,758,798	M419L	probably benign	Het
Slc38a8	T	C	8: 119,482,655	D393G	probably benign	Het
Slc6a3	A	G	13: 73,557,080	D230G	probably benign	Het
Smc1b	T	C	15: 85,112,815	T535A	probably damaging	Het
Smg7	G	C	1: 152,845,583	P626R	probably damaging	Het
Smu1	C	T	4: 40,755,722	V48M	probably benign	Het
Spag17	T	C	3: 100,027,351	Y650H	possibly damaging	Het
Spata1	C	T	3: 146,475,298	V302I	possibly damaging	Het
Sptb	G	A	12: 76,603,603	A1780V	probably damaging	Het
Srrm2	G	A	17: 23,819,617		probably benign	Het
Sspo	A	C	6: 48,497,443	N4933H	probably damaging	Het
Sult2a2	T	C	7: 13,734,873	I88T	probably benign	Het
Tgfa	G	T	6: 86,270,090		probably benign	Het
Thsd1	T	A	8: 22,243,692	C252S	possibly damaging	Het
Tmem102	T	A	11: 69,804,804	H114L	probably damaging	Het
Tnni3k	T	A	3: 154,792,777	K808N	possibly damaging	Het
Trpm7	G	T	2: 126,797,793	L1628M	probably benign	Het
Ttn	A	G	2: 76,730,737	Y29107H	probably damaging	Het
Upb1	T	C	10: 75,438,165	L342P	probably damaging	Het
Vmn2r120	T	C	17: 57,525,829	T117A	probably benign	Het
Vmn2r16	A	G	5: 109,339,786	D175G	probably damaging	Het
Zfhx4	T	G	3: 5,399,870	M1696R	possibly damaging	Het
Zfp746	A	G	6: 48,064,922	V289A	possibly damaging	Het
Zfyve26	A	C	12: 79,272,127	F1146V	probably damaging	Het

Other mutations in Rnf216

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Rnf216	APN	5	143068910	missense	possibly damaging	0.67
IGL02502:Rnf216	APN	5	143068867	missense	probably damaging	1.00
IGL02536:Rnf216	APN	5	143080240	missense	probably benign	0.04
IGL03196:Rnf216	APN	5	143081011	missense	probably damaging	1.00
PIT4445001:Rnf216	UTSW	5	143086003	missense	probably damaging	1.00
R0270:Rnf216	UTSW	5	143080241	missense	possibly damaging	0.63
R0422:Rnf216	UTSW	5	143015654	nonsense	probably null
R0422:Rnf216	UTSW	5	143090370	missense	probably benign	0.15
R0782:Rnf216	UTSW	5	143068892	missense	possibly damaging	0.64
R1917:Rnf216	UTSW	5	142992806	missense	probably benign	0.03
R2233:Rnf216	UTSW	5	143090926	missense	probably benign
R2234:Rnf216	UTSW	5	143090926	missense	probably benign
R2235:Rnf216	UTSW	5	143090926	missense	probably benign
R2340:Rnf216	UTSW	5	143080334	missense	probably damaging	0.99
R3015:Rnf216	UTSW	5	143075725	critical splice donor site	probably null
R3726:Rnf216	UTSW	5	143027946	missense	probably damaging	0.96
R4231:Rnf216	UTSW	5	143093090	missense	probably damaging	1.00
R4885:Rnf216	UTSW	5	143090580	nonsense	probably null
R4942:Rnf216	UTSW	5	143093059	missense	probably damaging	1.00
R4973:Rnf216	UTSW	5	143090316	missense	probably benign
R5291:Rnf216	UTSW	5	143090212	missense	probably benign
R5307:Rnf216	UTSW	5	143093002	missense	probably damaging	1.00
R5328:Rnf216	UTSW	5	143092999	missense	possibly damaging	0.84
R5416:Rnf216	UTSW	5	143015771	nonsense	probably null
R5888:Rnf216	UTSW	5	143068314	splice site	probably null
R6048:Rnf216	UTSW	5	143068904	missense	probably damaging	1.00
R6451:Rnf216	UTSW	5	142992834	missense	possibly damaging	0.80
R6595:Rnf216	UTSW	5	143090657	missense	probably benign	0.00
R7422:Rnf216	UTSW	5	143090836	missense	probably benign	0.01
R7470:Rnf216	UTSW	5	142992725	missense	possibly damaging	0.88
R7504:Rnf216	UTSW	5	143075759	missense	probably benign	0.27
R7507:Rnf216	UTSW	5	143089802	missense	probably damaging	1.00
R7695:Rnf216	UTSW	5	143085904	missense	possibly damaging	0.80
R7757:Rnf216	UTSW	5	143080236	missense	probably damaging	1.00
R7768:Rnf216	UTSW	5	143098444	start codon destroyed	probably null	1.00
R8056:Rnf216	UTSW	5	142992861	missense	probably benign	0.02
R8081:Rnf216	UTSW	5	143027964	missense	probably damaging	0.98
Z1176:Rnf216	UTSW	5	143098443	start codon destroyed	probably null	0.99
Z1177:Rnf216	UTSW	5	142992807	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTAACTATGCCAACTGCCATCACC -3'
(R):5'- TAGCCTGTAGCTGAGTCACTGCAC -3'

Sequencing Primer
(F):5'- ACTGCCATCACCAACCTTCTC -3'
(R):5'- CCCTGTAAGTGCAGTGTAGGAG -3'

Posted On

2014-01-05