Incidental Mutation 'R1109:Mkrn1'
ID98636
Institutional Source Beutler Lab
Gene Symbol Mkrn1
Ensembl Gene ENSMUSG00000029922
Gene Namemakorin, ring finger protein, 1
Synonyms
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location39397804-39420462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39399334 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 382 (M382K)
Ref Sequence ENSEMBL: ENSMUSP00000110471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031985] [ENSMUST00000051671] [ENSMUST00000114823]
Predicted Effect probably damaging
Transcript: ENSMUST00000031985
AA Change: M446K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031985
Gene: ENSMUSG00000029922
AA Change: M446K

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 334 2.09e-7 SMART
low complexity region 349 363 N/A INTRINSIC
ZnF_C3H1 366 392 2.53e-2 SMART
Pfam:MKRN1_C 400 479 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051671
SMART Domains Protein: ENSMUSP00000084244
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 328 4.72e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114823
AA Change: M382K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110471
Gene: ENSMUSG00000029922
AA Change: M382K

DomainStartEndE-ValueType
ZnF_C3H1 1 17 6.26e1 SMART
ZnF_C3H1 21 46 8.27e-7 SMART
low complexity region 58 78 N/A INTRINSIC
ZnF_C3H1 144 170 1.13e-4 SMART
RING 217 270 2.09e-7 SMART
low complexity region 285 299 N/A INTRINSIC
ZnF_C3H1 302 328 2.53e-2 SMART
low complexity region 378 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122874
Predicted Effect probably benign
Transcript: ENSMUST00000122996
SMART Domains Protein: ENSMUSP00000115231
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 75 96 4.11e-2 SMART
ZnF_C3H1 100 125 8.27e-7 SMART
low complexity region 137 157 N/A INTRINSIC
ZnF_C3H1 223 249 1.13e-4 SMART
RING 296 343 4.72e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000150575
AA Change: C194S
SMART Domains Protein: ENSMUSP00000121563
Gene: ENSMUSG00000029922
AA Change: C194S

DomainStartEndE-ValueType
RING 52 105 2.09e-7 SMART
low complexity region 170 191 N/A INTRINSIC
Meta Mutation Damage Score 0.2371 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and fertile, and show normal kidney morphology, eyelid development, and skeletal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Mkrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Mkrn1 APN 6 39405913 missense possibly damaging 0.80
IGL03235:Mkrn1 APN 6 39401330 missense probably damaging 1.00
R0127:Mkrn1 UTSW 6 39399275 missense probably benign 0.19
R0445:Mkrn1 UTSW 6 39404854 missense probably benign 0.28
R1366:Mkrn1 UTSW 6 39405917 missense probably benign 0.02
R1783:Mkrn1 UTSW 6 39400456 missense probably null
R2002:Mkrn1 UTSW 6 39405803 missense probably benign 0.00
R4671:Mkrn1 UTSW 6 39405757 missense probably damaging 1.00
R4889:Mkrn1 UTSW 6 39420005 unclassified probably benign
Z1088:Mkrn1 UTSW 6 39400456 missense probably null
Predicted Primers PCR Primer
(F):5'- GATCACAGCACCTGGAGTTTGAGAG -3'
(R):5'- TGCCACACGGTTTACCTGATGAG -3'

Sequencing Primer
(F):5'- GAGAGCCACACGCACTG -3'
(R):5'- CGGTTTACCTGATGAGCAACAG -3'
Posted On2014-01-05