Incidental Mutation 'R1109:Tgfa'
ID98641
Institutional Source Beutler Lab
Gene Symbol Tgfa
Ensembl Gene ENSMUSG00000029999
Gene Nametransforming growth factor alpha
Synonyms
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1109 (G1)
Quality Score222
Status Validated
Chromosome6
Chromosomal Location86195223-86275719 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 86270090 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032066] [ENSMUST00000192058]
Predicted Effect probably benign
Transcript: ENSMUST00000032066
SMART Domains Protein: ENSMUSP00000032066
Gene: ENSMUSG00000029999

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 45 82 1.01e-1 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192058
SMART Domains Protein: ENSMUSP00000141395
Gene: ENSMUSG00000029999

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4TGF|A 39 71 4e-17 PDB
SCOP:d1ioxa_ 42 71 8e-11 SMART
Blast:EGF 45 71 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194449
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family of proteins that regulate cellular proliferation. The encoded protein undergoes proteolytic processing to generate a soluble glycoprotein that is secreted by the cell. The secreted protein binds to the EGF receptors to initiate signaling events resulting in cellular proliferation, mucous production or inhibition of gastric acid secretion. The transgenic expression of the encoded protein in mice induces the development of cancers in various tissues such as liver, pancreas, skin and mammary glands. Mice lacking the encoded protein exhibit a wavy coat and curly whiskers phenotype as well as abnormalities in the eye. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants have curly vibrissae, wavy hair with misaligned hair follicles, reduced body weight, and eye defects including open eyelids at birth, corneal scarring and microphthalmia. Some heterozygotes show mild forms of the eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Tgfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Tgfa APN 6 86271421 missense probably benign 0.01
R0745:Tgfa UTSW 6 86271435 missense probably damaging 0.99
R5054:Tgfa UTSW 6 86270082 splice site probably null
R7602:Tgfa UTSW 6 86269962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAGCACAAGGACAGCGATCAC -3'
(R):5'- GCTCCAGTATTCACACAGCTTGCC -3'

Sequencing Primer
(F):5'- CAAGTGTGTCCTTGGCAAAGC -3'
(R):5'- ACAGCTTGCCTGACACTG -3'
Posted On2014-01-05