Incidental Mutation 'R1109:9030624J02Rik'
ID98648
Institutional Source Beutler Lab
Gene Symbol 9030624J02Rik
Ensembl Gene ENSMUSG00000030982
Gene NameRIKEN cDNA 9030624J02 gene
Synonyms
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118740226-118842966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118775329 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 351 (I351F)
Ref Sequence ENSEMBL: ENSMUSP00000051263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033280] [ENSMUST00000059390] [ENSMUST00000106552] [ENSMUST00000106553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033280
AA Change: I88F

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000059390
AA Change: I351F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051263
Gene: ENSMUSG00000030982
AA Change: I351F

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106552
AA Change: I327F

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102162
Gene: ENSMUSG00000030982
AA Change: I327F

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106553
AA Change: I327F

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102163
Gene: ENSMUSG00000030982
AA Change: I327F

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129334
Meta Mutation Damage Score 0.1835 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in 9030624J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:9030624J02Rik APN 7 118797047 critical splice donor site probably null
IGL00229:9030624J02Rik APN 7 118804191 splice site probably benign
IGL01066:9030624J02Rik APN 7 118773011 splice site probably null
IGL01433:9030624J02Rik APN 7 118774051 splice site probably null
IGL02381:9030624J02Rik APN 7 118775375 missense probably damaging 1.00
IGL02566:9030624J02Rik APN 7 118752832 missense probably benign 0.04
IGL03199:9030624J02Rik APN 7 118766388 missense probably benign 0.18
IGL03224:9030624J02Rik APN 7 118792553 unclassified probably benign
R0535:9030624J02Rik UTSW 7 118748181 missense possibly damaging 0.95
R1378:9030624J02Rik UTSW 7 118794572 nonsense probably null
R1378:9030624J02Rik UTSW 7 118794573 missense probably damaging 1.00
R1412:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R1474:9030624J02Rik UTSW 7 118760213 missense probably damaging 1.00
R1586:9030624J02Rik UTSW 7 118809972 missense probably damaging 1.00
R1785:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1786:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1921:9030624J02Rik UTSW 7 118833748 missense probably damaging 0.98
R1971:9030624J02Rik UTSW 7 118775334 missense probably damaging 1.00
R2038:9030624J02Rik UTSW 7 118811874 missense probably damaging 0.98
R2107:9030624J02Rik UTSW 7 118794539 unclassified probably benign
R2130:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2131:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2132:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2133:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2405:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R2411:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R3910:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3911:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3912:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3971:9030624J02Rik UTSW 7 118833799 missense probably damaging 0.98
R4697:9030624J02Rik UTSW 7 118791448 missense probably damaging 1.00
R4964:9030624J02Rik UTSW 7 118780268 missense possibly damaging 0.84
R4980:9030624J02Rik UTSW 7 118807009 missense probably damaging 1.00
R5034:9030624J02Rik UTSW 7 118791388 missense probably damaging 0.99
R5309:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5312:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5743:9030624J02Rik UTSW 7 118797011 missense possibly damaging 0.89
R6017:9030624J02Rik UTSW 7 118809921 missense probably damaging 1.00
R6089:9030624J02Rik UTSW 7 118746435 missense possibly damaging 0.76
R6320:9030624J02Rik UTSW 7 118753849 missense probably benign 0.08
R6415:9030624J02Rik UTSW 7 118792646 missense probably damaging 1.00
R6861:9030624J02Rik UTSW 7 118743675 missense probably damaging 1.00
R7034:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7036:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7339:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R7456:9030624J02Rik UTSW 7 118804117 missense probably benign 0.01
X0028:9030624J02Rik UTSW 7 118800452 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACTGCCTTGGCAAGCTGAAAC -3'
(R):5'- GGTAACGACGACCTTAAACGTCCC -3'

Sequencing Primer
(F):5'- TGGCAAGCTGAAACTTTGACC -3'
(R):5'- AGAACTGTGGTAAGTTGGTCTACTTC -3'
Posted On2014-01-05