Incidental Mutation 'R1109:Dnmt1'
ID98657
Institutional Source Beutler Lab
Gene Symbol Dnmt1
Ensembl Gene ENSMUSG00000004099
Gene NameDNA methyltransferase (cytosine-5) 1
SynonymsMTase, Dnmt1o, Cxxc9, MommeD2
MMRRC Submission 039182-MU
Accession Numbers

Genbank: NM_010066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20907209-20959888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20922388 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 451 (Y451N)
Ref Sequence ENSEMBL: ENSMUSP00000136669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]
Predicted Effect probably damaging
Transcript: ENSMUST00000004202
AA Change: Y570N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099
AA Change: Y570N

DomainStartEndE-ValueType
DMAP_binding 16 106 1.7e-13 SMART
low complexity region 121 143 N/A INTRINSIC
low complexity region 156 166 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 306 328 N/A INTRINSIC
Pfam:DNMT1-RFD 405 540 4.8e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Pfam:zf-CXXC 648 694 2.7e-17 PFAM
low complexity region 701 711 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
BAH 758 884 4.62e-31 SMART
BAH 935 1103 1.79e-37 SMART
low complexity region 1110 1124 N/A INTRINSIC
Pfam:DNA_methylase 1142 1596 1.3e-49 PFAM
low complexity region 1600 1619 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177754
AA Change: Y451N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099
AA Change: Y451N

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
Pfam:DNMT1-RFD 286 421 3.4e-40 PFAM
low complexity region 491 506 N/A INTRINSIC
Pfam:zf-CXXC 529 575 2.3e-17 PFAM
low complexity region 582 592 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
BAH 639 765 4.62e-31 SMART
BAH 816 984 1.79e-37 SMART
low complexity region 991 1005 N/A INTRINSIC
Pfam:DNA_methylase 1023 1477 1.3e-49 PFAM
low complexity region 1481 1500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178110
AA Change: Y451N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099
AA Change: Y451N

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 38 48 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
Pfam:DNMT1-RFD 287 422 2.6e-40 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:zf-CXXC 530 576 4.7e-17 PFAM
low complexity region 583 593 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
BAH 640 766 4.62e-31 SMART
BAH 817 985 1.79e-37 SMART
low complexity region 992 1006 N/A INTRINSIC
Pfam:DNA_methylase 1024 1478 8e-50 PFAM
low complexity region 1482 1501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216540
AA Change: Y452N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]
Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Dnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dnmt1 APN 9 20910270 missense possibly damaging 0.94
IGL01093:Dnmt1 APN 9 20909785 missense possibly damaging 0.88
IGL01160:Dnmt1 APN 9 20917319 missense possibly damaging 0.90
IGL01704:Dnmt1 APN 9 20910180 missense probably damaging 1.00
IGL02105:Dnmt1 APN 9 20907882 missense unknown
IGL02124:Dnmt1 APN 9 20908549 missense probably damaging 1.00
IGL02188:Dnmt1 APN 9 20941738 nonsense probably null
IGL02409:Dnmt1 APN 9 20926497 missense probably benign 0.00
IGL02579:Dnmt1 APN 9 20918120 missense possibly damaging 0.79
IGL02625:Dnmt1 APN 9 20927146 missense probably benign 0.01
IGL02794:Dnmt1 APN 9 20936551 missense probably benign
IGL02795:Dnmt1 APN 9 20927111 missense probably benign 0.12
IGL02938:Dnmt1 APN 9 20941373 missense probably benign 0.23
IGL03245:Dnmt1 APN 9 20915760 missense probably damaging 0.99
IGL03303:Dnmt1 APN 9 20926710 missense probably benign
B5639:Dnmt1 UTSW 9 20907968 splice site probably benign
PIT4576001:Dnmt1 UTSW 9 20911775 missense probably benign 0.28
R0071:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0180:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0368:Dnmt1 UTSW 9 20941757 missense probably damaging 0.99
R0387:Dnmt1 UTSW 9 20918213 missense probably damaging 1.00
R0529:Dnmt1 UTSW 9 20911550 missense probably damaging 1.00
R0532:Dnmt1 UTSW 9 20918556 splice site probably benign
R0612:Dnmt1 UTSW 9 20918193 missense probably damaging 0.98
R1298:Dnmt1 UTSW 9 20941456 missense probably benign
R1345:Dnmt1 UTSW 9 20908518 missense probably damaging 1.00
R1472:Dnmt1 UTSW 9 20932176 missense probably benign 0.28
R1654:Dnmt1 UTSW 9 20936574 missense possibly damaging 0.75
R1817:Dnmt1 UTSW 9 20927126 missense probably benign
R1836:Dnmt1 UTSW 9 20918246 missense probably damaging 1.00
R1957:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R1958:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R2097:Dnmt1 UTSW 9 20909788 missense probably benign 0.00
R2145:Dnmt1 UTSW 9 20937155 splice site probably benign
R2326:Dnmt1 UTSW 9 20924146 splice site probably benign
R4199:Dnmt1 UTSW 9 20938118 missense probably benign 0.00
R4456:Dnmt1 UTSW 9 20909842 missense probably damaging 1.00
R4518:Dnmt1 UTSW 9 20911978 missense probably benign 0.00
R4586:Dnmt1 UTSW 9 20926693 missense probably benign 0.05
R4836:Dnmt1 UTSW 9 20908558 missense probably damaging 1.00
R5014:Dnmt1 UTSW 9 20912254 missense probably benign 0.07
R5338:Dnmt1 UTSW 9 20952719 missense probably benign 0.44
R5385:Dnmt1 UTSW 9 20918480 missense probably damaging 1.00
R5579:Dnmt1 UTSW 9 20920205 missense probably damaging 1.00
R5645:Dnmt1 UTSW 9 20922147 missense probably damaging 1.00
R5719:Dnmt1 UTSW 9 20912595 missense possibly damaging 0.86
R5881:Dnmt1 UTSW 9 20952717 missense probably damaging 0.97
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6143:Dnmt1 UTSW 9 20927134 missense probably benign 0.30
R6342:Dnmt1 UTSW 9 20909793 nonsense probably null
R6374:Dnmt1 UTSW 9 20924045 missense possibly damaging 0.73
R6953:Dnmt1 UTSW 9 20918526 missense probably benign
R6990:Dnmt1 UTSW 9 20915814 nonsense probably null
R7089:Dnmt1 UTSW 9 20908489 missense probably damaging 0.99
R7463:Dnmt1 UTSW 9 20912225 missense possibly damaging 0.86
R7522:Dnmt1 UTSW 9 20920202 missense probably damaging 0.99
X0026:Dnmt1 UTSW 9 20913914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGCCTCCTCTGGTCTCAAGC -3'
(R):5'- TTGATGGAGCCCAGCAAAGAGTATG -3'

Sequencing Primer
(F):5'- GGTCTCAAGCCTCCAATCTG -3'
(R):5'- acccctgcctagaactcc -3'
Posted On2014-01-05