Incidental Mutation 'R1109:Gps2'
ID98672
Institutional Source Beutler Lab
Gene Symbol Gps2
Ensembl Gene ENSMUSG00000023170
Gene NameG protein pathway suppressor 2
SynonymsAMF-1
MMRRC Submission 039182-MU
Accession Numbers

Ncbi RefSeq: NM_019726.3; MGI:1891751

Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69913888-69916591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69915681 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 177 (H177Q)
Ref Sequence ENSEMBL: ENSMUSP00000112062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043419] [ENSMUST00000057884] [ENSMUST00000061837] [ENSMUST00000070996] [ENSMUST00000071026] [ENSMUST00000072581] [ENSMUST00000108607] [ENSMUST00000108608] [ENSMUST00000108609] [ENSMUST00000108610] [ENSMUST00000108611] [ENSMUST00000108612] [ENSMUST00000108613] [ENSMUST00000108617] [ENSMUST00000116358] [ENSMUST00000133203] [ENSMUST00000134581] [ENSMUST00000152589] [ENSMUST00000153652] [ENSMUST00000164359] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000043419
SMART Domains Protein: ENSMUSP00000047008
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
eIF-5a 83 150 2.43e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000057884
AA Change: H177Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054072
Gene: ENSMUSG00000023170
AA Change: H177Q

DomainStartEndE-ValueType
Pfam:G_path_suppress 5 294 6.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070996
SMART Domains Protein: ENSMUSP00000067077
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071026
SMART Domains Protein: ENSMUSP00000068651
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072581
AA Change: H177Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072389
Gene: ENSMUSG00000023170
AA Change: H177Q

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108607
SMART Domains Protein: ENSMUSP00000104247
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108608
SMART Domains Protein: ENSMUSP00000104248
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108609
SMART Domains Protein: ENSMUSP00000104249
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108610
SMART Domains Protein: ENSMUSP00000104250
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108611
SMART Domains Protein: ENSMUSP00000104251
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108612
SMART Domains Protein: ENSMUSP00000104252
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108613
SMART Domains Protein: ENSMUSP00000104253
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108617
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116358
AA Change: H177Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112062
Gene: ENSMUSG00000023170
AA Change: H177Q

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124596
Predicted Effect probably benign
Transcript: ENSMUST00000132183
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134581
Predicted Effect probably benign
Transcript: ENSMUST00000152589
SMART Domains Protein: ENSMUSP00000123402
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 2e-39 SMART
Pfam:eIF-5a 83 149 6.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153652
SMART Domains Protein: ENSMUSP00000137459
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
Pfam:eIF-5a 5 72 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164359
SMART Domains Protein: ENSMUSP00000132717
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175761
Predicted Effect probably benign
Transcript: ENSMUST00000177138
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177476
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in G protein-mitogen-activated protein kinase (MAPK) signaling cascades. When overexpressed in mammalian cells, this gene could potently suppress a RAS- and MAPK-mediated signal and interfere with JNK activity, suggesting that the function of this gene may be signal repression. The encoded protein is an integral subunit of the NCOR1-HDAC3 (nuclear receptor corepressor 1-histone deacetylase 3) complex, and it was shown that the complex inhibits JNK activation through this subunit and thus could potentially provide an alternative mechanism for hormone-mediated antagonism of AP1 (activator protein 1) function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Gps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R1086:Gps2 UTSW 11 69915224 unclassified probably benign
R1938:Gps2 UTSW 11 69915369 missense probably benign
R1964:Gps2 UTSW 11 69916420 missense probably benign 0.03
R2355:Gps2 UTSW 11 69915381 frame shift probably null
R3773:Gps2 UTSW 11 69916101 missense probably damaging 0.99
R4765:Gps2 UTSW 11 69916361 unclassified probably benign
R4811:Gps2 UTSW 11 69915928 missense probably damaging 0.99
R5119:Gps2 UTSW 11 69914791 missense probably benign 0.00
R5183:Gps2 UTSW 11 69915197 missense probably benign 0.00
R5218:Gps2 UTSW 11 69916295 critical splice donor site probably null
R5965:Gps2 UTSW 11 69914794 missense possibly damaging 0.60
R7172:Gps2 UTSW 11 69916436 missense probably benign 0.40
R7562:Gps2 UTSW 11 69916482 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CACAATCGCCCAGGTACTCTGATG -3'
(R):5'- TGGCTGAGATAGGTACTGCACTGC -3'

Sequencing Primer
(F):5'- GATGTTTGGACCACAAGTGC -3'
(R):5'- AATGCTGATGGGGCTGAG -3'
Posted On2014-01-05