Mutagenetix > Incidental Mutations

Incidental Mutation 'R1109:Sptb'

98678

Institutional Source

Beutler Lab

Gene Symbol

Sptb

Ensembl Gene

ENSMUSG00000021061

Gene Name

spectrin beta, erythrocytic

Synonyms

LOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1

MMRRC Submission

039182-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.875) question?

Stock #

R1109 (G1)

Quality Score

116

Status

Validated

Chromosome

Chromosomal Location

76580488-76710547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76603603 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1780 (A1780V)

Ref Sequence

ENSEMBL: ENSMUSP00000129782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021458
AA Change: A1780V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: A1780V

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.04e-10	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2193	4.32e-9	SMART
PH	2180	2291	8.98e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166101
AA Change: A1780V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: A1780V

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.87e-11	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2117	1.16e-9	SMART

Meta Mutation Damage Score

0.3457

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 88.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	T	7: 118,775,329	I351F	probably damaging	Het
Abcd3	T	G	3: 121,779,596	E262D	probably damaging	Het
Abcg1	G	A	17: 31,111,236	A504T	probably benign	Het
Acot11	T	C	4: 106,749,348	T515A	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Arhgap44	T	A	11: 65,026,816	H375L	probably benign	Het
Aspm	A	T	1: 139,456,758	I98F	probably damaging	Het
Atp8b5	T	C	4: 43,305,719		probably benign	Het
Ccdc129	G	T	6: 55,968,260	K655N	probably damaging	Het
Coa3	T	C	11: 101,278,785	K48R	probably damaging	Het
Col12a1	A	G	9: 79,699,723	S473P	probably damaging	Het
Dnmt1	A	T	9: 20,922,388	Y451N	probably damaging	Het
Dock5	A	G	14: 67,806,478	Y819H	possibly damaging	Het
Dtx1	G	A	5: 120,710,419		probably benign	Het
Dus2	T	A	8: 106,053,482	F479I	probably benign	Het
Esrp1	T	C	4: 11,365,205	E262G	probably damaging	Het
Exoc4	A	G	6: 33,442,016	Y466C	probably damaging	Het
Fasn	A	G	11: 120,812,324	F1625S	possibly damaging	Het
Fbxw25	A	T	9: 109,650,060	H374Q	probably benign	Het
Focad	T	C	4: 88,196,747		probably benign	Het
Gad2	G	T	2: 22,681,394	R448L	probably damaging	Het
Gad2	G	A	2: 22,690,159		probably benign	Het
Galnt16	G	T	12: 80,590,631	E377D	probably benign	Het
Gcc1	A	C	6: 28,419,167	L389R	probably damaging	Het
Ggct	A	T	6: 54,989,569		probably benign	Het
Gm7052	G	A	17: 22,040,152		probably benign	Het
Gps2	T	A	11: 69,915,681	H177Q	possibly damaging	Het
Heg1	T	A	16: 33,763,591	L1256Q	probably damaging	Het
Ikbkap	T	C	4: 56,786,723	T407A	probably benign	Het
Il1f6	G	A	2: 24,216,590	G62E	probably damaging	Het
Il3ra	C	T	14: 14,349,317	R138W	probably damaging	Het
Kdm4b	T	A	17: 56,399,430	I848N	probably damaging	Het
L3hypdh	A	G	12: 72,073,996	V327A	possibly damaging	Het
Lepr	G	T	4: 101,771,355	L552F	probably damaging	Het
Lpin3	T	C	2: 160,899,021	I449T	probably damaging	Het
Lrrn1	A	G	6: 107,567,264	K8E	probably benign	Het
Mex3a	G	T	3: 88,536,660	D348Y	possibly damaging	Het
Mindy2	G	A	9: 70,631,079	R325*	probably null	Het
Mkrn1	A	T	6: 39,399,334	M382K	probably damaging	Het
Mroh1	G	T	15: 76,446,509		probably benign	Het
Myo15	T	A	11: 60,493,066	D1646E	probably damaging	Het
Neu2	A	G	1: 87,596,728	D145G	probably damaging	Het
Olfr317	T	C	11: 58,732,916	Y83C	probably benign	Het
Olfr718-ps1	A	T	5: 143,137,619	N216K	probably benign	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Plekhm2	T	A	4: 141,627,984	I938F	probably benign	Het
Pnmal1	A	T	7: 16,961,467	K416*	probably null	Het
Ppid	T	C	3: 79,598,861	S198P	probably benign	Het
Rabl6	G	T	2: 25,587,526	P304Q	probably damaging	Het
Rasal2	A	T	1: 157,177,638		probably benign	Het
Ripor1	G	T	8: 105,618,928		probably benign	Het
Rnf216	A	T	5: 143,068,369	L658Q	probably damaging	Het
Rnf219	A	T	14: 104,479,764	L391*	probably null	Het
Safb	T	A	17: 56,601,228		probably benign	Het
Sf3b5	T	C	10: 13,008,753	M44T	probably benign	Het
Slc26a9	A	T	1: 131,758,798	M419L	probably benign	Het
Slc38a8	T	C	8: 119,482,655	D393G	probably benign	Het
Slc6a3	A	G	13: 73,557,080	D230G	probably benign	Het
Smc1b	T	C	15: 85,112,815	T535A	probably damaging	Het
Smg7	G	C	1: 152,845,583	P626R	probably damaging	Het
Smu1	C	T	4: 40,755,722	V48M	probably benign	Het
Spag17	T	C	3: 100,027,351	Y650H	possibly damaging	Het
Spata1	C	T	3: 146,475,298	V302I	possibly damaging	Het
Srrm2	G	A	17: 23,819,617		probably benign	Het
Sspo	A	C	6: 48,497,443	N4933H	probably damaging	Het
Sult2a2	T	C	7: 13,734,873	I88T	probably benign	Het
Tgfa	G	T	6: 86,270,090		probably benign	Het
Thsd1	T	A	8: 22,243,692	C252S	possibly damaging	Het
Tmem102	T	A	11: 69,804,804	H114L	probably damaging	Het
Tnni3k	T	A	3: 154,792,777	K808N	possibly damaging	Het
Trpm7	G	T	2: 126,797,793	L1628M	probably benign	Het
Ttn	A	G	2: 76,730,737	Y29107H	probably damaging	Het
Upb1	T	C	10: 75,438,165	L342P	probably damaging	Het
Vmn2r120	T	C	17: 57,525,829	T117A	probably benign	Het
Vmn2r16	A	G	5: 109,339,786	D175G	probably damaging	Het
Zfhx4	T	G	3: 5,399,870	M1696R	possibly damaging	Het
Zfp746	A	G	6: 48,064,922	V289A	possibly damaging	Het
Zfyve26	A	C	12: 79,272,127	F1146V	probably damaging	Het

Other mutations in Sptb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Sptb	APN	12	76621331	missense	probably benign	0.00
IGL00160:Sptb	APN	12	76623169	missense	probably damaging	1.00
IGL00229:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL00820:Sptb	APN	12	76632477	missense	probably damaging	1.00
IGL01309:Sptb	APN	12	76587463	missense	probably benign	0.16
IGL01408:Sptb	APN	12	76613147	missense	possibly damaging	0.93
IGL01450:Sptb	APN	12	76624240	missense	possibly damaging	0.89
IGL01455:Sptb	APN	12	76612912	missense	probably damaging	1.00
IGL01457:Sptb	APN	12	76612555	splice site	probably benign
IGL01680:Sptb	APN	12	76630682	missense	probably damaging	1.00
IGL02070:Sptb	APN	12	76605539	missense	possibly damaging	0.82
IGL02346:Sptb	APN	12	76621014	missense	probably damaging	1.00
IGL02452:Sptb	APN	12	76609036	critical splice donor site	probably null
IGL02515:Sptb	APN	12	76606487	missense	possibly damaging	0.51
IGL02545:Sptb	APN	12	76607980	critical splice donor site	probably null
IGL02644:Sptb	APN	12	76605617	missense	probably damaging	1.00
IGL02878:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL03007:Sptb	APN	12	76621341	missense	probably damaging	1.00
IGL03220:Sptb	APN	12	76612910	missense	probably benign	0.06
IGL03343:Sptb	APN	12	76583556	unclassified	probably benign
IGL03098:Sptb	UTSW	12	76621499	missense	probably damaging	1.00
PIT4472001:Sptb	UTSW	12	76620686	missense	probably damaging	1.00
R0047:Sptb	UTSW	12	76622950	missense	probably damaging	0.99
R0365:Sptb	UTSW	12	76600383	missense	probably benign	0.12
R0373:Sptb	UTSW	12	76621371	missense	probably benign	0.03
R0704:Sptb	UTSW	12	76583594	missense	probably damaging	0.99
R1005:Sptb	UTSW	12	76601859	critical splice donor site	probably null
R1264:Sptb	UTSW	12	76612607	missense	probably damaging	1.00
R1358:Sptb	UTSW	12	76621321	frame shift	probably null
R1358:Sptb	UTSW	12	76621326	missense	probably damaging	1.00
R1459:Sptb	UTSW	12	76611883	missense	probably benign	0.01
R1518:Sptb	UTSW	12	76604024	missense	possibly damaging	0.95
R1628:Sptb	UTSW	12	76583848	missense	probably damaging	1.00
R1668:Sptb	UTSW	12	76621169	missense	probably benign
R1677:Sptb	UTSW	12	76629649	missense	probably damaging	1.00
R1687:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R1695:Sptb	UTSW	12	76620867	missense	probably benign	0.10
R1708:Sptb	UTSW	12	76612574	missense	probably damaging	1.00
R1761:Sptb	UTSW	12	76612608	missense	probably damaging	0.96
R1925:Sptb	UTSW	12	76622253	missense	probably damaging	1.00
R2011:Sptb	UTSW	12	76632472	missense	possibly damaging	0.95
R2373:Sptb	UTSW	12	76621161	missense	probably damaging	1.00
R2517:Sptb	UTSW	12	76649869	missense	possibly damaging	0.55
R2918:Sptb	UTSW	12	76598758	missense	probably damaging	0.97
R2961:Sptb	UTSW	12	76603582	missense	probably benign	0.19
R3409:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3410:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3411:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3744:Sptb	UTSW	12	76600400	missense	probably benign
R4112:Sptb	UTSW	12	76597779	missense	probably damaging	0.99
R4177:Sptb	UTSW	12	76613179	missense	probably benign	0.25
R4194:Sptb	UTSW	12	76613010	missense	probably benign	0.44
R4301:Sptb	UTSW	12	76612697	missense	probably damaging	1.00
R4555:Sptb	UTSW	12	76612851	missense	probably benign	0.03
R4619:Sptb	UTSW	12	76583807	nonsense	probably null
R4620:Sptb	UTSW	12	76583807	nonsense	probably null
R4625:Sptb	UTSW	12	76587326	splice site	probably null
R4728:Sptb	UTSW	12	76583379	missense	probably benign	0.00
R4751:Sptb	UTSW	12	76627110	missense	probably benign	0.07
R4810:Sptb	UTSW	12	76623197	nonsense	probably null
R4888:Sptb	UTSW	12	76609037	missense	probably benign	0.00
R4894:Sptb	UTSW	12	76624994	critical splice donor site	probably null
R5114:Sptb	UTSW	12	76609278	missense	probably damaging	1.00
R5191:Sptb	UTSW	12	76612834	missense	probably benign	0.12
R5479:Sptb	UTSW	12	76599851	missense	probably benign	0.04
R5646:Sptb	UTSW	12	76587441	missense	probably benign
R5725:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5727:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5797:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R5874:Sptb	UTSW	12	76598727	missense	possibly damaging	0.91
R5952:Sptb	UTSW	12	76632384	missense	probably benign	0.02
R5956:Sptb	UTSW	12	76604168	missense	probably benign
R6298:Sptb	UTSW	12	76620654	critical splice donor site	probably null
R6470:Sptb	UTSW	12	76612829	missense	probably damaging	1.00
R6477:Sptb	UTSW	12	76606392	missense	probably damaging	1.00
R6736:Sptb	UTSW	12	76613180	missense	possibly damaging	0.49
R6854:Sptb	UTSW	12	76603480	missense	probably damaging	1.00
R6969:Sptb	UTSW	12	76608007	missense	probably damaging	1.00
R6987:Sptb	UTSW	12	76613247	missense	probably benign	0.00
R7023:Sptb	UTSW	12	76625088	missense	probably damaging	1.00
R7366:Sptb	UTSW	12	76604194	missense	probably damaging	1.00
R7379:Sptb	UTSW	12	76610877	missense	probably damaging	1.00
R7389:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7392:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7477:Sptb	UTSW	12	76628565	missense	probably damaging	1.00
R7653:Sptb	UTSW	12	76628497	missense	probably benign	0.06
R7684:Sptb	UTSW	12	76612195	missense	probably benign	0.06
R7733:Sptb	UTSW	12	76597921	splice site	probably null
R7846:Sptb	UTSW	12	76608526	nonsense	probably null
R8048:Sptb	UTSW	12	76628559	missense	probably benign	0.02
R8261:Sptb	UTSW	12	76621262	missense	probably benign	0.06
R8324:Sptb	UTSW	12	76619162	missense	possibly damaging	0.73
R8512:Sptb	UTSW	12	76602052	missense	possibly damaging	0.51
R8515:Sptb	UTSW	12	76612041	missense	probably benign	0.10
X0057:Sptb	UTSW	12	76630739	missense	probably benign
Z1176:Sptb	UTSW	12	76620733	nonsense	probably null
Z1177:Sptb	UTSW	12	76583584	missense	probably damaging	1.00
Z1177:Sptb	UTSW	12	76606445	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- GCTAATGACTGTCTGAGAGCTGCTG -3'
(R):5'- TGACAAGTTCCGAGACTTTGCCC -3'

Sequencing Primer
(F):5'- TCCCTTGTAGGAGCCAAGTG -3'
(R):5'- ACGATCATTGAGCGGCTCAT -3'

Posted On

2014-01-05