Incidental Mutation 'R1109:Olfr743'
ID98684
Institutional Source Beutler Lab
Gene Symbol Olfr743
Ensembl Gene ENSMUSG00000094285
Gene Nameolfactory receptor 743
SynonymsOlfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50521839-50534955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50533702 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 97 (S97P)
Ref Sequence ENSEMBL: ENSMUSP00000150946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071294
AA Change: S97P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: S97P

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.6e-56 PFAM
Pfam:7tm_1 45 294 1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215793
AA Change: S97P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1199 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Olfr743
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr743 APN 14 50533949 missense probably damaging 1.00
IGL01551:Olfr743 APN 14 50534161 missense probably benign
IGL02024:Olfr743 APN 14 50533850 missense probably benign 0.00
IGL02867:Olfr743 APN 14 50533513 missense probably benign
IGL02889:Olfr743 APN 14 50533513 missense probably benign
IGL03195:Olfr743 APN 14 50533420 missense probably benign
IGL03296:Olfr743 APN 14 50533945 missense possibly damaging 0.90
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0102:Olfr743 UTSW 14 50533631 missense probably damaging 1.00
R0556:Olfr743 UTSW 14 50533924 missense probably benign 0.01
R0626:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0661:Olfr743 UTSW 14 50534095 missense probably benign
R0759:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0761:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0894:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1110:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1312:Olfr743 UTSW 14 50534195 missense probably benign
R1446:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1502:Olfr743 UTSW 14 50533777 missense possibly damaging 0.47
R1518:Olfr743 UTSW 14 50534165 missense probably damaging 1.00
R1529:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1624:Olfr743 UTSW 14 50533643 missense probably damaging 1.00
R1646:Olfr743 UTSW 14 50533583 missense probably benign 0.01
R1687:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1795:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R2011:Olfr743 UTSW 14 50533684 missense probably damaging 1.00
R2120:Olfr743 UTSW 14 50533946 missense probably damaging 1.00
R2697:Olfr743 UTSW 14 50533781 missense probably damaging 1.00
R2857:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R2858:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R3906:Olfr743 UTSW 14 50533754 missense probably benign 0.03
R4327:Olfr743 UTSW 14 50533514 missense probably benign 0.05
R4355:Olfr743 UTSW 14 50533759 missense possibly damaging 0.94
R4663:Olfr743 UTSW 14 50533604 missense probably damaging 1.00
R5214:Olfr743 UTSW 14 50534347 makesense probably null
R5964:Olfr743 UTSW 14 50534198 missense probably damaging 0.99
R6148:Olfr743 UTSW 14 50534321 missense probably benign 0.00
R6167:Olfr743 UTSW 14 50534155 missense probably damaging 1.00
R6301:Olfr743 UTSW 14 50534254 missense probably benign 0.02
R6616:Olfr743 UTSW 14 50533907 missense probably benign 0.43
R6910:Olfr743 UTSW 14 50533873 missense probably benign 0.31
R7076:Olfr743 UTSW 14 50533821 nonsense probably null
R7483:Olfr743 UTSW 14 50534015 missense probably benign 0.06
R7574:Olfr743 UTSW 14 50534313 missense probably benign 0.01
R7731:Olfr743 UTSW 14 50533684 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGCTTTCACAGAACACAGACAG -3'
(R):5'- ACTGATCACAAGGATGTTGCAGAGG -3'

Sequencing Primer
(F):5'- ACAGGCTTCATCCTTTTGGG -3'
(R):5'- GCGCCTAGTCATGAGAGAAG -3'
Posted On2014-01-05