Mutagenetix > Incidental Mutation

Incidental Mutation 'R1024:Rpe65'

98745

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

039126-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R1024 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 159606485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 207 (I207T)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]

AlphaFold

Q91ZQ5

Predicted Effect

probably benign
Transcript: ENSMUST00000029824
AA Change: I207T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: I207T

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196999
AA Change: I207T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: I207T

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197771

SMART Domains

Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174

Domain	Start	End	E-Value	Type
Pfam:RPE65	13	109	5.8e-19	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.4%
10x: 95.6%
20x: 90.2%

Validation Efficiency

90% (36/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	T	C	7: 75,677,409	S719P	probably damaging	Het
Atxn2l	A	T	7: 126,497,294	N425K	probably benign	Het
B3galt4	G	A	17: 33,950,839	R142C	probably damaging	Het
Cacna2d2	T	C	9: 107,527,050		probably null	Het
Ccar2	A	G	14: 70,140,515	S674P	probably damaging	Het
Ccm2	T	A	11: 6,570,119	Y56*	probably null	Het
Cdc14b	A	T	13: 64,215,676	V257E	probably damaging	Het
Cdca8	A	C	4: 124,922,005	S171R	probably benign	Het
Cep192	C	T	18: 67,838,054	T1042I	probably benign	Het
Cfap100	T	A	6: 90,413,004	T101S	possibly damaging	Het
Cfap46	T	A	7: 139,642,597	M1155L	probably benign	Het
Cyp3a13	T	A	5: 137,894,364	I473F	possibly damaging	Het
Dclk3	A	G	9: 111,469,070	I561V	possibly damaging	Het
Dock6	A	T	9: 21,833,612	L556H	probably damaging	Het
Dqx1	G	A	6: 83,061,089	C486Y	probably damaging	Het
Drd1	T	A	13: 54,053,314	M294L	probably benign	Het
Dsel	A	G	1: 111,860,673	S711P	probably damaging	Het
Fcho2	A	T	13: 98,732,659	I568N	probably damaging	Het
Folr1	A	G	7: 101,858,603	M210T	probably damaging	Het
Gatc	T	A	5: 115,340,845		probably null	Het
Gja8	A	T	3: 96,919,424	F307L	probably benign	Het
H1fnt	G	A	15: 98,256,755	T171I	unknown	Het
Hnrnpd	C	A	5: 99,966,157	*87L	probably null	Het
Hpd	C	T	5: 123,174,469	R279H	possibly damaging	Het
Igfals	G	A	17: 24,880,483	V183M	probably damaging	Het
Izumo1	A	G	7: 45,627,174	Y387C	probably benign	Het
Kdm5a	A	G	6: 120,399,038	N585S	probably null	Het
March2	C	A	17: 33,709,788	G45C	probably damaging	Het
Myo15	A	T	11: 60,479,616	R1067S	probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nell1	A	G	7: 50,120,663	S157G	probably damaging	Het
Nf1	A	T	11: 79,547,033	E2072D	probably damaging	Het
Nipal1	CGGG	CGG	5: 72,667,991		probably null	Het
Nop2	T	A	6: 125,137,186	V205E	probably benign	Het
Nphs1	G	T	7: 30,474,277	S939I	probably damaging	Het
Nudt8	T	A	19: 4,001,925	W179R	probably damaging	Het
Nutm1	A	T	2: 112,249,929	I547N	probably benign	Het
Olfr729	A	T	14: 50,147,927	F316I	probably benign	Het
Olfr921	C	A	9: 38,775,335	L27I	probably damaging	Het
Oog2	A	C	4: 144,196,286	T374P	probably damaging	Het
Otud4	T	A	8: 79,664,093	M413K	probably benign	Het
Pear1	A	G	3: 87,760,299		probably benign	Het
Pla2g3	G	A	11: 3,488,551	C67Y	probably damaging	Het
Plxdc2	A	G	2: 16,712,106	T334A	probably benign	Het
Ppl	G	A	16: 5,100,000	R543W	probably damaging	Het
Prl5a1	G	A	13: 28,149,897	V128I	probably damaging	Het
Pth1r	T	C	9: 110,729,621	D96G	probably benign	Het
Pth1r	A	T	9: 110,742,227	L25Q	probably damaging	Het
Rfpl4	G	T	7: 5,110,518	D215E	probably damaging	Het
Rnf146	T	A	10: 29,347,096	R265*	probably null	Het
Rptn	A	G	3: 93,398,225	E955G	possibly damaging	Het
Rwdd2b	A	T	16: 87,436,850	C121S	probably damaging	Het
Scn10a	A	G	9: 119,609,274	I1843T	probably damaging	Het
Sirt5	A	G	13: 43,370,769	I6V	probably benign	Het
Slc25a36	A	G	9: 97,079,201	Y261H	probably damaging	Het
Slc5a3	G	A	16: 92,077,495	A147T	probably damaging	Het
Stk39	T	C	2: 68,410,046	S114G	probably damaging	Het
Stxbp1	T	C	2: 32,814,967		probably null	Het
Syt3	G	T	7: 44,390,682	G113V	probably damaging	Het
Tatdn2	A	G	6: 113,709,545	T644A	probably damaging	Het
Trim9	T	A	12: 70,252,017		probably null	Het
Tut1	A	G	19: 8,959,355	N181S	probably benign	Het
Vill	T	C	9: 119,066,824	S151P	probably damaging	Het
Vmn2r90	A	T	17: 17,728,138	I549F	probably damaging	Het
Wdfy4	T	C	14: 33,079,966	T1912A	possibly damaging	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCTAAATAGGAGACCAGTCATGGA -3'
(R):5'- GTCACCTGGTAGGATACAAATGAGAGGA -3'

Sequencing Primer
(F):5'- GCTCATAAGTGTGCAACTGAAAC -3'
(R):5'- GAGGAAGTCTTATTAAATTCGAGAGC -3'

Posted On

2014-01-09