Incidental Mutation 'R1024:Rfpl4'
ID98751
Institutional Source Beutler Lab
Gene Symbol Rfpl4
Ensembl Gene ENSMUSG00000035191
Gene Nameret finger protein-like 4
SynonymsD7Ertd486e
MMRRC Submission 039126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1024 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5109787-5116950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5110518 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 215 (D215E)
Ref Sequence ENSEMBL: ENSMUSP00000146891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045215] [ENSMUST00000179971] [ENSMUST00000208468]
Predicted Effect probably damaging
Transcript: ENSMUST00000045215
AA Change: D221E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039519
Gene: ENSMUSG00000035191
AA Change: D221E

DomainStartEndE-ValueType
RING 14 52 4.52e-3 SMART
PRY 95 147 2.51e-10 SMART
SPRY 148 275 2e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179971
AA Change: D221E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136497
Gene: ENSMUSG00000035191
AA Change: D221E

DomainStartEndE-ValueType
RING 14 52 4.52e-3 SMART
PRY 95 147 2.51e-10 SMART
SPRY 148 275 2e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208468
AA Change: D215E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 90% (36/40)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,677,409 S719P probably damaging Het
Atxn2l A T 7: 126,497,294 N425K probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Cacna2d2 T C 9: 107,527,050 probably null Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Ccm2 T A 11: 6,570,119 Y56* probably null Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cdca8 A C 4: 124,922,005 S171R probably benign Het
Cep192 C T 18: 67,838,054 T1042I probably benign Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Cfap46 T A 7: 139,642,597 M1155L probably benign Het
Cyp3a13 T A 5: 137,894,364 I473F possibly damaging Het
Dclk3 A G 9: 111,469,070 I561V possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Dsel A G 1: 111,860,673 S711P probably damaging Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
Gja8 A T 3: 96,919,424 F307L probably benign Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
Izumo1 A G 7: 45,627,174 Y387C probably benign Het
Kdm5a A G 6: 120,399,038 N585S probably null Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nipal1 CGGG CGG 5: 72,667,991 probably null Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nphs1 G T 7: 30,474,277 S939I probably damaging Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Nutm1 A T 2: 112,249,929 I547N probably benign Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Olfr921 C A 9: 38,775,335 L27I probably damaging Het
Oog2 A C 4: 144,196,286 T374P probably damaging Het
Otud4 T A 8: 79,664,093 M413K probably benign Het
Pear1 A G 3: 87,760,299 probably benign Het
Pla2g3 G A 11: 3,488,551 C67Y probably damaging Het
Plxdc2 A G 2: 16,712,106 T334A probably benign Het
Ppl G A 16: 5,100,000 R543W probably damaging Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rnf146 T A 10: 29,347,096 R265* probably null Het
Rpe65 T C 3: 159,606,485 I207T probably benign Het
Rptn A G 3: 93,398,225 E955G possibly damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc25a36 A G 9: 97,079,201 Y261H probably damaging Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stk39 T C 2: 68,410,046 S114G probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vill T C 9: 119,066,824 S151P probably damaging Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Wdfy4 T C 14: 33,079,966 T1912A possibly damaging Het
Other mutations in Rfpl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03377:Rfpl4 APN 7 5110465 missense probably damaging 1.00
R0285:Rfpl4 UTSW 7 5110378 missense probably benign 0.01
R0727:Rfpl4 UTSW 7 5115293 missense probably benign 0.20
R1529:Rfpl4 UTSW 7 5110712 missense probably damaging 1.00
R1625:Rfpl4 UTSW 7 5115410 missense possibly damaging 0.62
R1714:Rfpl4 UTSW 7 5110358 missense probably benign 0.34
R1960:Rfpl4 UTSW 7 5115534 nonsense probably null
R2167:Rfpl4 UTSW 7 5110853 missense probably damaging 1.00
R2185:Rfpl4 UTSW 7 5115500 missense probably damaging 1.00
R4385:Rfpl4 UTSW 7 5110670 missense possibly damaging 0.93
R5988:Rfpl4 UTSW 7 5115502 missense probably damaging 1.00
R7082:Rfpl4 UTSW 7 5115559 missense probably benign 0.01
R7212:Rfpl4 UTSW 7 5110660 missense probably damaging 1.00
R7772:Rfpl4 UTSW 7 5115544 missense probably benign 0.05
R8271:Rfpl4 UTSW 7 5110540 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACTCAGCGACTGTCATAGCAGC -3'
(R):5'- GTGCAGAAAGATTCCATCCCTCCC -3'

Sequencing Primer
(F):5'- TTCCGAAAATGCCTGGATTTGTC -3'
(R):5'- ACTTCAGGCCGCCATTACTG -3'
Posted On2014-01-09