Incidental Mutation 'R1024:Nphs1'
ID98752
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Namenephrosis 1, nephrin
Synonymsnephrin
MMRRC Submission 039126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1024 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30458315-30487223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30474277 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 939 (S939I)
Ref Sequence ENSEMBL: ENSMUSP00000116500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: S953I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S953I

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123880
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: S939I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S939I

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149086
Meta Mutation Damage Score 0.1566 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 90% (36/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,677,409 S719P probably damaging Het
Atxn2l A T 7: 126,497,294 N425K probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Cacna2d2 T C 9: 107,527,050 probably null Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Ccm2 T A 11: 6,570,119 Y56* probably null Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cdca8 A C 4: 124,922,005 S171R probably benign Het
Cep192 C T 18: 67,838,054 T1042I probably benign Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Cfap46 T A 7: 139,642,597 M1155L probably benign Het
Cyp3a13 T A 5: 137,894,364 I473F possibly damaging Het
Dclk3 A G 9: 111,469,070 I561V possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Dsel A G 1: 111,860,673 S711P probably damaging Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
Gja8 A T 3: 96,919,424 F307L probably benign Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
Izumo1 A G 7: 45,627,174 Y387C probably benign Het
Kdm5a A G 6: 120,399,038 N585S probably null Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nipal1 CGGG CGG 5: 72,667,991 probably null Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Nutm1 A T 2: 112,249,929 I547N probably benign Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Olfr921 C A 9: 38,775,335 L27I probably damaging Het
Oog2 A C 4: 144,196,286 T374P probably damaging Het
Otud4 T A 8: 79,664,093 M413K probably benign Het
Pear1 A G 3: 87,760,299 probably benign Het
Pla2g3 G A 11: 3,488,551 C67Y probably damaging Het
Plxdc2 A G 2: 16,712,106 T334A probably benign Het
Ppl G A 16: 5,100,000 R543W probably damaging Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rfpl4 G T 7: 5,110,518 D215E probably damaging Het
Rnf146 T A 10: 29,347,096 R265* probably null Het
Rpe65 T C 3: 159,606,485 I207T probably benign Het
Rptn A G 3: 93,398,225 E955G possibly damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc25a36 A G 9: 97,079,201 Y261H probably damaging Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stk39 T C 2: 68,410,046 S114G probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vill T C 9: 119,066,824 S151P probably damaging Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Wdfy4 T C 14: 33,079,966 T1912A possibly damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGCTCATGTGCCAGATACCC -3'
(R):5'- CATACCTGCATGGCGAGAACAGTC -3'

Sequencing Primer
(F):5'- cagatacccacaggttgtgag -3'
(R):5'- TGGCGAGAACAGTCAGCTC -3'
Posted On2014-01-09