Incidental Mutation 'R1024:Akap13'
ID98754
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission 039126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1024 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75677409 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 719 (S719P)
Ref Sequence ENSEMBL: ENSMUSP00000146990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
Predicted Effect probably damaging
Transcript: ENSMUST00000147005
AA Change: S1522P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: S1522P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166315
AA Change: S1526P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: S1526P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207079
Predicted Effect probably damaging
Transcript: ENSMUST00000207750
AA Change: S1522P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207923
AA Change: S719P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000207998
AA Change: S221P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208456
Predicted Effect unknown
Transcript: ENSMUST00000208708
AA Change: S364P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209040
Meta Mutation Damage Score 0.0967 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 90% (36/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Cacna2d2 T C 9: 107,527,050 probably null Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Ccm2 T A 11: 6,570,119 Y56* probably null Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cdca8 A C 4: 124,922,005 S171R probably benign Het
Cep192 C T 18: 67,838,054 T1042I probably benign Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Cfap46 T A 7: 139,642,597 M1155L probably benign Het
Cyp3a13 T A 5: 137,894,364 I473F possibly damaging Het
Dclk3 A G 9: 111,469,070 I561V possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Dsel A G 1: 111,860,673 S711P probably damaging Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
Gja8 A T 3: 96,919,424 F307L probably benign Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
Izumo1 A G 7: 45,627,174 Y387C probably benign Het
Kdm5a A G 6: 120,399,038 N585S probably null Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nipal1 CGGG CGG 5: 72,667,991 probably null Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nphs1 G T 7: 30,474,277 S939I probably damaging Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Nutm1 A T 2: 112,249,929 I547N probably benign Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Olfr921 C A 9: 38,775,335 L27I probably damaging Het
Oog2 A C 4: 144,196,286 T374P probably damaging Het
Otud4 T A 8: 79,664,093 M413K probably benign Het
Pear1 A G 3: 87,760,299 probably benign Het
Pla2g3 G A 11: 3,488,551 C67Y probably damaging Het
Plxdc2 A G 2: 16,712,106 T334A probably benign Het
Ppl G A 16: 5,100,000 R543W probably damaging Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rfpl4 G T 7: 5,110,518 D215E probably damaging Het
Rnf146 T A 10: 29,347,096 R265* probably null Het
Rpe65 T C 3: 159,606,485 I207T probably benign Het
Rptn A G 3: 93,398,225 E955G possibly damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc25a36 A G 9: 97,079,201 Y261H probably damaging Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stk39 T C 2: 68,410,046 S114G probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vill T C 9: 119,066,824 S151P probably damaging Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Wdfy4 T C 14: 33,079,966 T1912A possibly damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7116:Akap13 UTSW 7 75720195 missense probably benign 0.00
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7468:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7650:Akap13 UTSW 7 75643454 missense probably benign 0.20
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACATTCTTCTCATGGCAGTGACG -3'
(R):5'- TTGATTCTCAAGGGACACCGAAGC -3'

Sequencing Primer
(F):5'- CTTCCTCAGACTTCAAAGTTAAACAG -3'
(R):5'- ATGCACAGGTCCCTGTCTTA -3'
Posted On2014-01-09