Incidental Mutation 'R1022:Gatc'
ID98775
Institutional Source Beutler Lab
Gene Symbol Gatc
Ensembl Gene ENSMUSG00000029536
Gene Nameglutamyl-tRNA(Gln) amidotransferase, subunit C
Synonyms2010003O18Rik
MMRRC Submission 039124-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R1022 (G1)
Quality Score122
Status Not validated
Chromosome5
Chromosomal Location115333239-115341178 bp(-) (GRCm38)
Type of Mutationunclassified (4797 bp from exon)
DNA Base Change (assembly) T to A at 115340845 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031508] [ENSMUST00000040154] [ENSMUST00000139167]
Predicted Effect probably benign
Transcript: ENSMUST00000031508
SMART Domains Protein: ENSMUSP00000031508
Gene: ENSMUSG00000029535

DomainStartEndE-ValueType
Pfam:UPF0203 1 70 1.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000040154
SMART Domains Protein: ENSMUSP00000047661
Gene: ENSMUSG00000041697

DomainStartEndE-ValueType
Pfam:COX6A 24 105 2.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137766
Predicted Effect probably damaging
Transcript: ENSMUST00000139167
AA Change: D102V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115090
Gene: ENSMUSG00000029536
AA Change: D102V

DomainStartEndE-ValueType
Pfam:Glu-tRNAGln 69 134 2e-11 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Gatc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Gatc APN 5 115340989 missense possibly damaging 0.67
IGL01774:Gatc APN 5 115341017 nonsense probably null
R1024:Gatc UTSW 5 115340845 unclassified probably null
R3153:Gatc UTSW 5 115335487 missense probably benign 0.24
R3612:Gatc UTSW 5 115335486 missense probably benign 0.42
R4666:Gatc UTSW 5 115335547 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCATTCCGCGAAATTTTAGCCAG -3'
(R):5'- TGCTTCCAAAGCGAATCCACAGG -3'

Sequencing Primer
(F):5'- ggacttggttcctatttacatcg -3'
(R):5'- CGAATCCACAGGGAAAGGTCC -3'
Posted On2014-01-09