Incidental Mutation 'R1022:Tatdn2'
ID98780
Institutional Source Beutler Lab
Gene Symbol Tatdn2
Ensembl Gene ENSMUSG00000056952
Gene NameTatD DNase domain containing 2
SynonymsmKIAA0218
MMRRC Submission 039124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1022 (G1)
Quality Score194
Status Not validated
Chromosome6
Chromosomal Location113697050-113711069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113709545 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 644 (T644A)
Ref Sequence ENSEMBL: ENSMUSP00000086412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089018] [ENSMUST00000113022] [ENSMUST00000153661] [ENSMUST00000204753]
Predicted Effect probably damaging
Transcript: ENSMUST00000089018
AA Change: T644A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086412
Gene: ENSMUSG00000056952
AA Change: T644A

DomainStartEndE-ValueType
low complexity region 63 95 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
Pfam:TatD_DNase 457 721 3.3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113022
AA Change: T705A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108645
Gene: ENSMUSG00000056952
AA Change: T705A

DomainStartEndE-ValueType
low complexity region 63 95 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 443 453 N/A INTRINSIC
Pfam:TatD_DNase 518 782 3.7e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138420
AA Change: T68A
SMART Domains Protein: ENSMUSP00000116559
Gene: ENSMUSG00000056952
AA Change: T68A

DomainStartEndE-ValueType
Pfam:TatD_DNase 1 146 2.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153661
SMART Domains Protein: ENSMUSP00000123557
Gene: ENSMUSG00000056952

DomainStartEndE-ValueType
Pfam:TatD_DNase 1 122 1.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200187
Predicted Effect probably damaging
Transcript: ENSMUST00000204753
AA Change: T705A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145308
Gene: ENSMUSG00000056952
AA Change: T705A

DomainStartEndE-ValueType
low complexity region 63 95 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 443 453 N/A INTRINSIC
Pfam:TatD_DNase 518 782 3.7e-61 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Tatdn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Tatdn2 APN 6 113704024 splice site probably benign
IGL01335:Tatdn2 APN 6 113704056 missense probably benign 0.29
IGL01459:Tatdn2 APN 6 113710031 splice site probably null
IGL02406:Tatdn2 APN 6 113704213 missense probably benign 0.41
IGL02728:Tatdn2 APN 6 113704715 missense probably damaging 1.00
R0321:Tatdn2 UTSW 6 113709501 missense probably damaging 1.00
R0506:Tatdn2 UTSW 6 113702589 missense probably benign 0.13
R0583:Tatdn2 UTSW 6 113702525 missense possibly damaging 0.80
R1024:Tatdn2 UTSW 6 113709545 missense probably damaging 1.00
R1301:Tatdn2 UTSW 6 113704115 missense probably damaging 1.00
R1454:Tatdn2 UTSW 6 113704327 missense probably benign 0.26
R1459:Tatdn2 UTSW 6 113710070 missense probably damaging 1.00
R1710:Tatdn2 UTSW 6 113697927 missense possibly damaging 0.90
R1771:Tatdn2 UTSW 6 113702099 critical splice acceptor site probably null
R2064:Tatdn2 UTSW 6 113704142 missense probably benign 0.41
R2065:Tatdn2 UTSW 6 113704142 missense probably benign 0.41
R2067:Tatdn2 UTSW 6 113704142 missense probably benign 0.41
R4446:Tatdn2 UTSW 6 113702540 critical splice donor site probably null
R4654:Tatdn2 UTSW 6 113707365 missense probably benign 0.09
R4888:Tatdn2 UTSW 6 113704605 missense possibly damaging 0.66
R7378:Tatdn2 UTSW 6 113704701 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGATGGCTGCCCACATTG -3'
(R):5'- ACCTATATCGCACAAGGTGGACCAG -3'

Sequencing Primer
(F):5'- TCAGTATCTGAACCTCATGCCAG -3'
(R):5'- CAGGAGGACACTGGGACTC -3'
Posted On2014-01-09