Mutagenetix > Incidental Mutations

Incidental Mutation 'R1022:Nell1'

98783

Institutional Source

Beutler Lab

Gene Symbol

Nell1

Ensembl Gene

ENSMUSG00000055409

Gene Name

NEL-like 1

Synonyms

B230343H07Rik, l7R6

MMRRC Submission

039124-MU

Accession Numbers

Genbank: NM_001037906; MGI: 2443902

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1022 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49974864-50866608 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50120663 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 157 (S157G)

Ref Sequence

ENSEMBL: ENSMUSP00000080550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]

Predicted Effect

probably damaging
Transcript: ENSMUST00000081872
AA Change: S157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: S157G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_CA	549	595	1.08e-10	SMART
EGF_like	596	635	1.84e-4	SMART
VWC	634	686	1.42e0	SMART
VWC	694	749	1.83e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107603
AA Change: S157G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: S157G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_like	549	588	1.84e-4	SMART
VWC	587	639	1.42e0	SMART
VWC	647	702	1.83e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145096

Predicted Effect

probably damaging
Transcript: ENSMUST00000151721
AA Change: S157G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409
AA Change: S157G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154410

Coding Region Coverage

1x: 98.9%
3x: 97.7%
10x: 94.5%
20x: 87.2%

Validation Efficiency

MGI Phenotype

Strain: 3626314
Lethality: E19-E21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn2l	A	T	7: 126,497,294	N425K	probably benign	Het
Ccar2	A	G	14: 70,140,515	S674P	probably damaging	Het
Cdc14b	A	T	13: 64,215,676	V257E	probably damaging	Het
Cfap100	T	A	6: 90,413,004	T101S	possibly damaging	Het
Dock6	A	T	9: 21,833,612	L556H	probably damaging	Het
Dqx1	G	A	6: 83,061,089	C486Y	probably damaging	Het
Drd1	T	A	13: 54,053,314	M294L	probably benign	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Fcho2	A	T	13: 98,732,659	I568N	probably damaging	Het
Folr1	A	G	7: 101,858,603	M210T	probably damaging	Het
Gatc	T	A	5: 115,340,845		probably null	Het
H1fnt	G	A	15: 98,256,755	T171I	unknown	Het
Hnrnpd	C	A	5: 99,966,157	*87L	probably null	Het
Hpd	C	T	5: 123,174,469	R279H	possibly damaging	Het
Igfals	G	A	17: 24,880,483	V183M	probably damaging	Het
March2	C	A	17: 33,709,788	G45C	probably damaging	Het
Myo15	A	T	11: 60,479,616	R1067S	probably benign	Het
Nf1	A	T	11: 79,547,033	E2072D	probably damaging	Het
Nop2	T	A	6: 125,137,186	V205E	probably benign	Het
Nudt8	T	A	19: 4,001,925	W179R	probably damaging	Het
Olfr729	A	T	14: 50,147,927	F316I	probably benign	Het
Otx2	TCTGCTGCTGCTGCTGCTG	TCTGCTGCTGCTGCTG	14: 48,659,272		probably benign	Het
Prl5a1	G	A	13: 28,149,897	V128I	probably damaging	Het
Pth1r	T	C	9: 110,729,621	D96G	probably benign	Het
Pth1r	A	T	9: 110,742,227	L25Q	probably damaging	Het
Rwdd2b	A	T	16: 87,436,850	C121S	probably damaging	Het
Scn10a	A	G	9: 119,609,274	I1843T	probably damaging	Het
Sirt5	A	G	13: 43,370,769	I6V	probably benign	Het
Slc5a3	G	A	16: 92,077,495	A147T	probably damaging	Het
Stxbp1	T	C	2: 32,814,967		probably null	Het
Syt3	G	T	7: 44,390,682	G113V	probably damaging	Het
Tatdn2	A	G	6: 113,709,545	T644A	probably damaging	Het
Trim9	T	A	12: 70,252,017		probably null	Het
Tut1	A	G	19: 8,959,355	N181S	probably benign	Het
Vmn2r90	A	T	17: 17,728,138	I549F	probably damaging	Het

Other mutations in Nell1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nell1	APN	7	50120673	missense	probably damaging	0.96
IGL01434:Nell1	APN	7	50701208	missense	probably benign	0.01
IGL01796:Nell1	APN	7	50176216	splice site	probably benign
IGL02048:Nell1	APN	7	50219607	missense	probably damaging	0.96
IGL02239:Nell1	APN	7	50249650	missense	probably benign	0.08
IGL02860:Nell1	APN	7	50848485	missense	probably damaging	0.99
IGL02958:Nell1	APN	7	50220337	critical splice donor site	probably null
IGL03143:Nell1	APN	7	50279533	nonsense	probably null
IGL03334:Nell1	APN	7	50062611	splice site	probably null
D6062:Nell1	UTSW	7	50258191	missense	probably benign	0.21
P0018:Nell1	UTSW	7	50120691	missense	probably damaging	1.00
R0004:Nell1	UTSW	7	50560759	splice site	probably benign
R0029:Nell1	UTSW	7	50120715	splice site	probably benign
R0029:Nell1	UTSW	7	50120715	splice site	probably benign
R0468:Nell1	UTSW	7	50228846	missense	probably damaging	0.97
R0483:Nell1	UTSW	7	50230180	missense	probably benign	0.07
R0732:Nell1	UTSW	7	50856387	missense	probably damaging	1.00
R0945:Nell1	UTSW	7	50219585	missense	probably benign	0.07
R1024:Nell1	UTSW	7	50120663	missense	probably damaging	1.00
R1075:Nell1	UTSW	7	50853840	missense	probably damaging	0.98
R1291:Nell1	UTSW	7	50230250	missense	probably benign	0.00
R1404:Nell1	UTSW	7	50853873	missense	possibly damaging	0.91
R1404:Nell1	UTSW	7	50853873	missense	possibly damaging	0.91
R1634:Nell1	UTSW	7	50848558	missense	possibly damaging	0.82
R1928:Nell1	UTSW	7	50701195	missense	possibly damaging	0.51
R2060:Nell1	UTSW	7	50560830	missense	possibly damaging	0.58
R2261:Nell1	UTSW	7	50560821	missense	possibly damaging	0.95
R2262:Nell1	UTSW	7	50560821	missense	possibly damaging	0.95
R2263:Nell1	UTSW	7	50560821	missense	possibly damaging	0.95
R2448:Nell1	UTSW	7	50856387	missense	probably damaging	1.00
R2869:Nell1	UTSW	7	50249657	intron	probably benign
R2870:Nell1	UTSW	7	50249657	intron	probably benign
R2871:Nell1	UTSW	7	50249657	intron	probably benign
R3498:Nell1	UTSW	7	50258179	missense	possibly damaging	0.55
R4044:Nell1	UTSW	7	50219619	missense	probably damaging	1.00
R4623:Nell1	UTSW	7	50120562	missense	possibly damaging	0.84
R4732:Nell1	UTSW	7	50856217	missense	probably damaging	1.00
R4733:Nell1	UTSW	7	50856217	missense	probably damaging	1.00
R4941:Nell1	UTSW	7	50062638	missense	probably benign	0.10
R4942:Nell1	UTSW	7	50120649	missense	possibly damaging	0.84
R5233:Nell1	UTSW	7	50176314	missense	probably damaging	0.99
R5590:Nell1	UTSW	7	50279611	missense	probably damaging	1.00
R5673:Nell1	UTSW	7	50228846	missense	probably damaging	0.99
R5741:Nell1	UTSW	7	50560890	unclassified	probably null
R6345:Nell1	UTSW	7	49975423	missense	possibly damaging	0.91
R6916:Nell1	UTSW	7	50701179	missense	probably benign	0.00
R7051:Nell1	UTSW	7	50448844	missense	unknown
R7302:Nell1	UTSW	7	50856269	missense	probably benign
R7339:Nell1	UTSW	7	50279549	missense	probably benign	0.01
R7831:Nell1	UTSW	7	49982800	missense	possibly damaging	0.85
R7913:Nell1	UTSW	7	50279522	missense	possibly damaging	0.93
R7914:Nell1	UTSW	7	49982800	missense	possibly damaging	0.85
R7994:Nell1	UTSW	7	50279522	missense	possibly damaging	0.93
Z1176:Nell1	UTSW	7	50560882	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGGGGCTAATGAACACCATGATGC -3'
(R):5'- GCAGCAAAGCTTCTCAGACTCATCC -3'

Sequencing Primer
(F):5'- GCCCAAGACTAAAGTCTTTGTTC -3'
(R):5'- ATGGAACTTCAGCCAGTGC -3'

Posted On

2014-01-09