Incidental Mutation 'R1022:Dock6'
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 039124-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R1022 (G1)
Quality Score225
Status Not validated
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21833612 bp
Amino Acid Change Leucine to Histidine at position 556 (L556H)
Ref Sequence ENSEMBL: ENSMUSP00000149156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000058777] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: L556H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: L556H

low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058777
SMART Domains Protein: ENSMUSP00000058951
Gene: ENSMUSG00000047822

low complexity region 171 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213296
Predicted Effect unknown
Transcript: ENSMUST00000216626
AA Change: L5H
Predicted Effect probably damaging
Transcript: ENSMUST00000217336
AA Change: L556H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
backwater UTSW 9 21824416 missense probably benign 0.29
bayfront UTSW 9 21821745 missense probably benign 0.29
marshland UTSW 9 21841603 missense probably benign 0.00
Shallows UTSW 9 21820622 missense probably benign
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 splice site probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7991:Dock6 UTSW 9 21846562 missense probably damaging 1.00
R7992:Dock6 UTSW 9 21832839 critical splice donor site probably null
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
R8184:Dock6 UTSW 9 21830300 missense possibly damaging 0.54
R8213:Dock6 UTSW 9 21831444 missense possibly damaging 0.77
R8560:Dock6 UTSW 9 21802836 missense probably benign 0.00
R8828:Dock6 UTSW 9 21846501 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-09