Incidental Mutation 'R1022:Prl5a1'
ID98798
Institutional Source Beutler Lab
Gene Symbol Prl5a1
Ensembl Gene ENSMUSG00000017064
Gene Nameprolactin family 5, subfamily a, member 1
SynonymsD13Wsu14e, 1600013P04Rik, Prlpl, PLP-L
MMRRC Submission 039124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1022 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location28142484-28151611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28149897 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 128 (V128I)
Ref Sequence ENSEMBL: ENSMUSP00000017208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017208]
Predicted Effect probably damaging
Transcript: ENSMUST00000017208
AA Change: V128I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017208
Gene: ENSMUSG00000017064
AA Change: V128I

DomainStartEndE-ValueType
Pfam:Hormone_1 17 230 4.8e-50 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Prl5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Prl5a1 APN 13 28145439 missense possibly damaging 0.77
IGL01820:Prl5a1 APN 13 28148700 missense probably benign 0.34
IGL02682:Prl5a1 APN 13 28145420 missense probably benign 0.32
R0266:Prl5a1 UTSW 13 28149987 missense possibly damaging 0.77
R1024:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R2098:Prl5a1 UTSW 13 28145505 missense probably damaging 1.00
R5467:Prl5a1 UTSW 13 28150011 missense possibly damaging 0.92
R6002:Prl5a1 UTSW 13 28145482 missense probably benign 0.00
R6026:Prl5a1 UTSW 13 28151264 missense probably benign 0.43
R6242:Prl5a1 UTSW 13 28142555 nonsense probably null
R6616:Prl5a1 UTSW 13 28149856 missense probably benign 0.00
R6733:Prl5a1 UTSW 13 28149936 missense possibly damaging 0.81
R6979:Prl5a1 UTSW 13 28151206 missense probably benign 0.32
R7692:Prl5a1 UTSW 13 28150014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTGCTAGACCAGCATTCTGC -3'
(R):5'- AGCTGCCACAGTCCTATTAGTCCC -3'

Sequencing Primer
(F):5'- GCATTCTGCATATCTGCTAGGAAC -3'
(R):5'- cctttcctttcctttcctttcctttc -3'
Posted On2014-01-09