Incidental Mutation 'R1022:Olfr729'
Institutional Source Beutler Lab
Gene Symbol Olfr729
Ensembl Gene ENSMUSG00000049011
Gene Nameolfactory receptor 729
SynonymsMOR246-6, GA_x6K02T2PMLR-5839874-5838903
MMRRC Submission 039124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1022 (G1)
Quality Score225
Status Not validated
Chromosomal Location50144731-50152910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50147927 bp
Amino Acid Change Phenylalanine to Isoleucine at position 316 (F316I)
Ref Sequence ENSEMBL: ENSMUSP00000149189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061020] [ENSMUST00000213163] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect probably benign
Transcript: ENSMUST00000061020
AA Change: F316I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051755
Gene: ENSMUSG00000049011
AA Change: F316I

Pfam:7tm_4 31 304 8.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.4e-5 PFAM
Pfam:7tm_1 41 287 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
AA Change: F316I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215327
AA Change: F316I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215451
AA Change: F316I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Olfr729
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Olfr729 APN 14 50148716 missense probably benign 0.38
IGL02736:Olfr729 APN 14 50148424 missense probably benign 0.01
IGL02798:Olfr729 APN 14 50148378 missense probably benign
IGL03267:Olfr729 APN 14 50148847 missense probably damaging 1.00
R0082:Olfr729 UTSW 14 50148055 missense probably damaging 0.97
R0225:Olfr729 UTSW 14 50148635 missense probably damaging 1.00
R0503:Olfr729 UTSW 14 50148478 missense probably damaging 1.00
R1024:Olfr729 UTSW 14 50147927 missense probably benign
R1424:Olfr729 UTSW 14 50148465 missense possibly damaging 0.83
R1440:Olfr729 UTSW 14 50148358 missense probably damaging 1.00
R1479:Olfr729 UTSW 14 50148788 missense probably benign 0.00
R1583:Olfr729 UTSW 14 50148774 missense probably benign 0.00
R1817:Olfr729 UTSW 14 50148271 missense probably benign 0.00
R2155:Olfr729 UTSW 14 50148697 missense probably damaging 1.00
R2282:Olfr729 UTSW 14 50148319 missense probably benign
R2926:Olfr729 UTSW 14 50148436 missense probably benign 0.19
R3790:Olfr729 UTSW 14 50148569 missense possibly damaging 0.51
R4073:Olfr729 UTSW 14 50148043 missense possibly damaging 0.55
R5945:Olfr729 UTSW 14 50148763 missense probably benign
R6714:Olfr729 UTSW 14 50148214 missense possibly damaging 0.95
R7112:Olfr729 UTSW 14 50147935 missense probably benign 0.00
R7157:Olfr729 UTSW 14 50148232 missense probably damaging 1.00
R7511:Olfr729 UTSW 14 50148256 missense probably damaging 1.00
R7815:Olfr729 UTSW 14 50148796 missense probably benign 0.36
R8833:Olfr729 UTSW 14 50148366 nonsense probably null
Z1177:Olfr729 UTSW 14 50148851 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-09