Incidental Mutation 'R0016:Kpna2'
ID98856
Institutional Source Beutler Lab
Gene Symbol Kpna2
Ensembl Gene ENSMUSG00000018362
Gene Namekaryopherin (importin) alpha 2
Synonyms2410044B12Rik, pendulin, m-importin-alpha-P1, m-importin, Rch1, Importin alpha
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R0016 (G1)
Quality Score78
Status Validated (trace)
Chromosome11
Chromosomal Location106988629-106999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106991086 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 305 (T305A)
Ref Sequence ENSEMBL: ENSMUSP00000018506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018506] [ENSMUST00000124541] [ENSMUST00000140362] [ENSMUST00000144834] [ENSMUST00000145331]
Predicted Effect probably benign
Transcript: ENSMUST00000018506
AA Change: T305A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018506
Gene: ENSMUSG00000018362
AA Change: T305A

DomainStartEndE-ValueType
Pfam:IBB 9 98 2.8e-32 PFAM
ARM 108 149 8.95e-7 SMART
ARM 151 191 1.33e-9 SMART
ARM 193 231 2.7e-1 SMART
ARM 241 280 1.74e-4 SMART
ARM 282 322 1.92e-6 SMART
ARM 324 364 2.76e-7 SMART
ARM 366 406 3.45e-8 SMART
ARM 409 449 2.17e-5 SMART
Pfam:Arm_3 458 509 3.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124541
SMART Domains Protein: ENSMUSP00000114636
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.7e-29 PFAM
Pfam:Arm 108 149 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140362
SMART Domains Protein: ENSMUSP00000118679
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 24 118 9.7e-30 PFAM
Pfam:Arm 127 168 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144834
SMART Domains Protein: ENSMUSP00000121655
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.1e-29 PFAM
Pfam:Arm 108 149 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145331
SMART Domains Protein: ENSMUSP00000122983
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 74 1.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156495
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Kpna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Kpna2 APN 11 106991201 missense probably benign 0.01
IGL02985:Kpna2 APN 11 106989337 missense probably benign 0.11
R0233:Kpna2 UTSW 11 106992631 missense probably benign 0.03
R0359:Kpna2 UTSW 11 106991322 missense probably damaging 1.00
R1450:Kpna2 UTSW 11 106997309 missense probably benign 0.05
R1750:Kpna2 UTSW 11 106991445 missense probably damaging 0.99
R4751:Kpna2 UTSW 11 106992664 missense possibly damaging 0.85
R4762:Kpna2 UTSW 11 106990259 missense probably benign 0.04
R4911:Kpna2 UTSW 11 106990719 missense probably damaging 1.00
R4952:Kpna2 UTSW 11 106991235 missense probably damaging 1.00
R4976:Kpna2 UTSW 11 106991469 missense probably damaging 1.00
R5283:Kpna2 UTSW 11 106990832 missense probably damaging 1.00
R5564:Kpna2 UTSW 11 106990745 missense probably damaging 1.00
R6870:Kpna2 UTSW 11 106992694 splice site probably null
R7599:Kpna2 UTSW 11 106998757 missense probably null
R7606:Kpna2 UTSW 11 106992058 missense probably damaging 0.99
R7672:Kpna2 UTSW 11 106988963 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTGCAAGTGCTCCTGCATC -3'
(R):5'- ACGCCGTTGAGCAGATTCTTCC -3'

Sequencing Primer
(F):5'- AGTGACAATATTCCCTATGGCTC -3'
(R):5'- TGAGCAGATTCTTCCTACGTTAG -3'
Posted On2014-01-10