Incidental Mutation 'R0011:Asic3'
ID98979
Institutional Source Beutler Lab
Gene Symbol Asic3
Ensembl Gene ENSMUSG00000038276
Gene Nameacid-sensing (proton-gated) ion channel 3
SynonymsDRASIC, Accn3
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0011 (G1)
Quality Score56
Status Validated
Chromosome5
Chromosomal Location24413392-24417835 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 24417492 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030814] [ENSMUST00000049346] [ENSMUST00000196296] [ENSMUST00000198990]
Predicted Effect probably benign
Transcript: ENSMUST00000030814
SMART Domains Protein: ENSMUSP00000030814
Gene: ENSMUSG00000028969

DomainStartEndE-ValueType
S_TKc 4 286 6.11e-101 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049346
SMART Domains Protein: ENSMUSP00000039914
Gene: ENSMUSG00000038276

DomainStartEndE-ValueType
Pfam:ASC 21 458 2.5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196296
SMART Domains Protein: ENSMUSP00000143083
Gene: ENSMUSG00000038276

DomainStartEndE-ValueType
Pfam:ASC 21 459 4e-155 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198241
Predicted Effect probably benign
Transcript: ENSMUST00000198442
Predicted Effect probably benign
Transcript: ENSMUST00000198990
SMART Domains Protein: ENSMUSP00000142413
Gene: ENSMUSG00000028969

DomainStartEndE-ValueType
Pfam:Pkinase 4 101 9.7e-23 PFAM
Pfam:Pkinase_Tyr 4 102 2.7e-13 PFAM
Pfam:Pkinase 97 254 6.6e-30 PFAM
Pfam:Pkinase_Tyr 102 200 9.4e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 2 has been observed as proton-gated channels sensitive to gadolinium. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced latency to onset of pain responses, increased sensitivity to light touch, but decreased sensitivity to noxious pinch and responses of acid- and noxious heat-sensitive nociceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Asic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Asic3 APN 5 24417721 missense probably benign 0.44
IGL02527:Asic3 APN 5 24416277 missense probably benign 0.00
IGL02869:Asic3 APN 5 24416974 nonsense probably null
E0370:Asic3 UTSW 5 24413987 missense probably damaging 1.00
IGL03047:Asic3 UTSW 5 24413790 missense probably benign
R0011:Asic3 UTSW 5 24417492 unclassified probably benign
R0245:Asic3 UTSW 5 24413838 missense probably damaging 1.00
R0270:Asic3 UTSW 5 24417702 missense probably benign 0.01
R1464:Asic3 UTSW 5 24413821 missense probably damaging 1.00
R1464:Asic3 UTSW 5 24413821 missense probably damaging 1.00
R1702:Asic3 UTSW 5 24415456 missense probably damaging 1.00
R1824:Asic3 UTSW 5 24413751 nonsense probably null
R3403:Asic3 UTSW 5 24416987 missense probably damaging 1.00
R3722:Asic3 UTSW 5 24416999 missense probably benign 0.08
R4383:Asic3 UTSW 5 24413934 missense probably damaging 1.00
R4573:Asic3 UTSW 5 24417192 missense probably damaging 1.00
R4794:Asic3 UTSW 5 24415897 missense probably damaging 0.96
R6701:Asic3 UTSW 5 24414129 missense possibly damaging 0.65
R7154:Asic3 UTSW 5 24413662 unclassified probably benign
R7569:Asic3 UTSW 5 24414048 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGGACTGTTTATCGGAGCCAGC -3'
(R):5'- CCTTGTCACGAGGTAACAGGTACG -3'

Sequencing Primer
(F):5'- TCCCCAGGTTTTTCAAGACAGAG -3'
(R):5'- CTTGGTGACAGCACTGGGAG -3'
Posted On2014-01-10