Incidental Mutation 'R0011:Klk1'
ID98981
Institutional Source Beutler Lab
Gene Symbol Klk1
Ensembl Gene ENSMUSG00000063903
Gene Namekallikrein 1
SynonymsKlk6, mGk-6
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0011 (G1)
Quality Score23
Status Validated
Chromosome7
Chromosomal Location44225360-44229618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44229535 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 149 (T149I)
Ref Sequence ENSEMBL: ENSMUSP00000146057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037220] [ENSMUST00000075162] [ENSMUST00000206144] [ENSMUST00000206366] [ENSMUST00000206686]
Predicted Effect probably benign
Transcript: ENSMUST00000037220
SMART Domains Protein: ENSMUSP00000048665
Gene: ENSMUSG00000038782

DomainStartEndE-ValueType
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072123
SMART Domains Protein: ENSMUSP00000071992
Gene: ENSMUSG00000062073

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075162
AA Change: T251I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074659
Gene: ENSMUSG00000063903
AA Change: T251I

DomainStartEndE-ValueType
Tryp_SPc 24 253 7.26e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205329
Predicted Effect probably benign
Transcript: ENSMUST00000206144
AA Change: T149I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000206366
Predicted Effect probably benign
Transcript: ENSMUST00000206686
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein are unable to generate significant levels of kinins in most tissues, develop cardiovascular abnormalities and exhibit hypercalciuria of renal origin. This gene is located in a cluster of several related kallikrein genes on chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Klk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Klk1 APN 7 44228596 missense probably damaging 0.98
IGL01788:Klk1 APN 7 44228983 missense probably benign 0.00
R0184:Klk1 UTSW 7 44228749 missense possibly damaging 0.50
R0853:Klk1 UTSW 7 44221498 unclassified probably benign
R0925:Klk1 UTSW 7 44228816 critical splice donor site probably null
R2044:Klk1 UTSW 7 44229034 missense possibly damaging 0.95
R2518:Klk1 UTSW 7 44220737 unclassified probably null
R2982:Klk1 UTSW 7 44229439 missense probably damaging 1.00
R3962:Klk1 UTSW 7 44229549 missense possibly damaging 0.87
R4041:Klk1 UTSW 7 44229562 missense probably damaging 1.00
R4067:Klk1 UTSW 7 44227544 nonsense probably null
R4385:Klk1 UTSW 7 44228569 missense probably benign 0.12
R4901:Klk1 UTSW 7 44228715 missense probably damaging 0.99
R5256:Klk1 UTSW 7 44221561 unclassified probably benign
R5580:Klk1 UTSW 7 44228814 missense probably benign 0.00
R5595:Klk1 UTSW 7 44228737 unclassified probably null
R6818:Klk1 UTSW 7 44229459 missense probably damaging 1.00
R7100:Klk1 UTSW 7 44229424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCTTGGTTCCCAGTTCAACAC -3'
(R):5'- TCCTTGCCAGAGGAGACTCATGTAG -3'

Sequencing Primer
(F):5'- GAGTCAGGTTGTCTACTAGAATCC -3'
(R):5'- GGAGACTCATGTAGTATCCCTGAC -3'
Posted On2014-01-10